Gene Card
Gene overview
cDNA / CDS / Protein Sequences
564 bp · TkA01G053400|TK1151|cDNA
ATGTATTGTCCTGGAGTTGGAGCATTTGCTGCAATGATGGACGTCTTAAACAATAACGGGATGGCTGAAGCACTTAGCACTTACATAGAGAATGATCGCCCATTTCTAGGCATTTGTCTTGGTCTTCAACTTCTCTTTGAGTCAAGTGAAGAAAACGTGCCAGTGAGAGGACTTGGCTTAATTCCTGGTGTGGTTGGGCGTTTTGATTCTTCTAATGGCTGTAGAGTGCCTCATATTGGCTGGATTGCTTTGGATATTAC...
564 bp · TkA01G053400|TK1151|CDS
ATGTATTGTCCTGGAGTTGGAGCATTTGCTGCAATGATGGACGTCTTAAACAATAACGGGATGGCTGAAGCACTTAGCACTTACATAGAGAATGATCGCCCATTTCTAGGCATTTGTCTTGGTCTTCAACTTCTCTTTGAGTCAAGTGAAGAAAACGTGCCAGTGAGAGGACTTGGCTTAATTCCTGGTGTGGTTGGGCGTTTTGATTCTTCTAATGGCTGTAGAGTGCCTCATATTGGCTGGATTGCTTTGGATATTAC...
Protein
Download Protein FASTA187 aa · TkA01G053400|TK1151|PROTEIN
MYCPGVGAFAAMMDVLNNNGMAEALSTYIENDRPFLGICLGLQLLFESSEENVPVRGLGLIPGVVGRFDSSNGCRVPHIGWIALDITKDSVILDDIISTSALRDRVHDESNRKEGRVQFGVVMLEILTGKQPIDPTIEDGLQIVDWVRQKRGGPQVLDATLRARPDPELEEMMQTLGVALLKEIRQT
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G053400 |
|---|---|
| TK1151 ID | TkA01G053400 |
| OH-1004 ID | LXL04_005416 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 81.500 |
| Protein coverage (%) | TK1151 89.840 / OH-1004 23.372Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G053400 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:13815223-13816943 (-) | |||||||||
| Description | Similar to RCH2: Receptor-like protein kinase 2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000105 L-histidine biosynthetic process Biological Process GO:0009266 response to temperature stimulus Biological Process GO:0009755 hormone-mediated signaling pathway Biological Process GO:0010074 maintenance of meristem identity Biological Process GO:0010078 maintenance of root meristem identity Biological Process GO:0010082 regulation of root meristem growth Biological Process GO:0010449 root meristem growth Biological Process GO:0080092 regulation of pollen tube growth Biological Process GO:2000280 regulation of root development Biological Process GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0009536 plastid Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G34110 ath:AT3G24240 ath:AT4G26900 ath:AT5G48940 ath:AT5G56040 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07685GATase_32-63 aaPF00117GATase4-53 aaPF13507GATase_513-48 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G053400 | PF07685 | GATase_3 | 2 | 63 | 1.1e-06 | 29.2 |
| TkA01G053400 | PF00117 | GATase | 4 | 53 | 3e-07 | 31.0 |
| TkA01G053400 | PF13507 | GATase_5 | 13 | 48 | 0.039 | 13.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.