TkA01G049070 | RubberDandelionOmics

Gene overview

TkA01G049070

Reference: TK1151 Chr: Chr01 Coordinates: 12683839-12687012 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1687 bp · TkA01G049070|TK1151|cDNA

AAATAACTCTTGCATTCTATGATATTGGCTACTTCGTTATTACCTTTTTTTTTATTAATTTTGTTCATATCTTTTGAGTTTTGACCCTTAAGGGCTTATGTTATAAAAAACTCTCTTGAACCTACCTCCGGCCTGCACCGTCCTCCGCCAGCGACTCTGGCAGCGCTGTCACTCCGCCAGCGACAGCACCCTCCGGGCATTTCGATCTTCTCTGTAGCTTCTCTCAACTCAGCAATGGATTCTACTGCGAAATCTTTCAA...

CDS

Download CDS FASTA

1383 bp · TkA01G049070|TK1151|CDS

ATGGATTCTACTGCGAAATCTTTCAATCCAAACAAGCATTTGAAAGAACAATTCGTCAGCAATCTTACTGGATCTTCCACACTCGAAGTTTTTCTACTTTCAGCAATATTCCCTATGCTTATTCTACTACGACATATCATCAGCATCTACAAAACAGTTAAAATCAAAGAAACTTCATCAAATCAAAAGGATACTTCAAGAACTCAAAGCGTTTACATCATCAGAATGACATTAGATTTCCTCTCAATTGTCCTTCCTAT...

Protein

Download Protein FASTA

460 aa · TkA01G049070|TK1151|PROTEIN

MDSTAKSFNPNKHLKEQFVSNLTGSSTLEVFLLSAIFPMLILLRHIISIYKTVKIKETSSNQKDTSRTQSVYIIRMTLDFLSIVLPITLFCTVLSEWTYMTAVVFISILFFSFAYKRHESWYQEEGNHSLREYISSYRVSMMLITCICILAVDFNIFPRRYAKTETYGTSLMDLGVGAFVFANSLVSRQARGISTMGLKCALSSTSPLLVLGFARLVFTSGVDYQVHVGEYGVHWNFFFTLAGVAVLTSLINISPNYCGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G049070`
TK1151 ID	TkA01G049070
OH-1004 ID	LXL04_005444
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 57.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G049070

Location Chr01:12683839-12687012 (+)

Description Similar to At4g17910: Uncharacterized protein At4g17910

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17910`	Uncharacterized protein At4g17910.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005444 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006506 GPI anchor biosynthetic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0032216 glucosaminyl-phosphatidylinositol O-acyltransferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT4G17910

ath:AT4G17920

ath:AT5G46650

ddi:DDB_G0286111

ncr:NCU00913

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.779

Rank 1 · TkA01G049070 · TK1151

Golgi apparatus0.094

Rank 2 · TkA01G049070 · TK1151

Nucleus0.093

Rank 3 · TkA01G049070 · TK1151

Cytoplasm0.066

Rank 4 · TkA01G049070 · TK1151

Cell membrane0.061

Rank 5 · TkA01G049070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06423GWT112-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G049070	`PF06423`	GWT1	12	447	2e-131	439.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B3H6K1`	Arabidopsis thaliana	sp\|B3H6K1\|Y4791_ARATH Uncharacterized protein At4g17910	54.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card