LXL04_005444 | RubberDandelionOmics

Gene overview

LXL04_005444

Reference: OH-1004 Chr: Chr01 Coordinates: 164244274-164248370 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2388 bp · LXL04_005444|LXL04_005444|OH1004|cDNA

ATGACGACGGAGGCTACAACCACCGTTGCACCGCCAGCAGATCCCAATGCCTCCCCTCCTGTCACCATCATTTTAACCACTATTCTCCTCGTCATTTTCTTTATTGGGTTCTTCACAATATACATTTGCAGGTGTTTCATGCAAAATGTTCTTTACACATGGAATAGTCGTCGTAACCAACCCGGGGCACAAATGGGTGGTCCAGGGAACAACGGAGCCACTGGACTCGACCCACATATTATTAAAACTTTCCCTACCTA...

CDS

Download CDS FASTA

2388 bp · LXL04_005444|LXL04_005444|OH1004|CDS

ATGACGACGGAGGCTACAACCACCGTTGCACCGCCAGCAGATCCCAATGCCTCCCCTCCTGTCACCATCATTTTAACCACTATTCTCCTCGTCATTTTCTTTATTGGGTTCTTCACAATATACATTTGCAGGTGTTTCATGCAAAATGTTCTTTACACATGGAATAGTCGTCGTAACCAACCCGGGGCACAAATGGGTGGTCCAGGGAACAACGGAGCCACTGGACTCGACCCACATATTATTAAAACTTTCCCTACCTA...

Protein

Download Protein FASTA

795 aa · LXL04_005444|LXL04_005444|OH1004|PROTEIN

MTTEATTTVAPPADPNASPPVTIILTTILLVIFFIGFFTIYICRCFMQNVLYTWNSRRNQPGAQMGGPGNNGATGLDPHIIKTFPTYIYSDVKKFRRKRYGLECAICLCEFEDDNVLRILTKCYHVFHQDCIDLWLESHKSCPFCRRGLETPLPSPEKSPISQHSTPMHEIHENELLEDTYTVNIGDENEMNNNTDATEENKTEKHVNIDIDRGEVKRTDKFPRSKSTGHSITKNSKTTEDEDKFTLRLPEHIQAKLIHG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005444`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005444

Location Chr01:164244274-164248370 (-)

Description Similar to At4g17910: Uncharacterized protein At4g17910

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17910`	Uncharacterized protein At4g17910.	No verified direct reference in this release
`At4g17920`	RING-H2 finger protein ATL29.	No verified direct reference in this release
`At5g46650`	RING-H2 finger protein ATL30.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005444 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006506 GPI anchor biosynthetic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0032216 glucosaminyl-phosphatidylinositol O-acyltransferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT4G17910

ath:AT4G17920

ath:AT5G46650

ddi:DDB_G0286111

ncr:NCU00913

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.451

Rank 1 · LXL04_005444 · OH-1004

Golgi apparatus0.215

Rank 2 · LXL04_005444 · OH-1004

Cell membrane0.153

Rank 3 · LXL04_005444 · OH-1004

Cytoplasm0.144

Rank 4 · LXL04_005444 · OH-1004

Nucleus0.119

Rank 5 · LXL04_005444 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2103-146 aa

PF17123.12zf-RING_11103-132 aa

PF13923.13zf-C3HC4_2103-145 aa

PF00097.32zf-C3HC4104-145 aa

PF12678.14zf-rbx1107-146 aa

PF12861.14zf-ANAPC11107-149 aa

PF06423.19GWT1347-782 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005444	`PF13639.13`	zf-RING_2	103	146	2.2e-13	50.9
LXL04_005444	`PF17123.12`	zf-RING_11	103	132	2.2e-08	34.4
LXL04_005444	`PF13923.13`	zf-C3HC4_2	103	145	3.2e-08	34.0
LXL04_005444	`PF00097.32`	zf-C3HC4	104	145	1.8e-06	28.4
LXL04_005444	`PF12678.14`	zf-rbx1	107	146	5.5e-09	36.8
LXL04_005444	`PF12861.14`	zf-ANAPC11	107	149	3.6e-06	27.6
LXL04_005444	`PF06423.19`	GWT1	347	782	1.4e-130	437.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B3H6K1`	Arabidopsis thaliana	Uncharacterized protein At4g17910	56.448%	Swiss-Prot	moderate database homology
`O49691`	Arabidopsis thaliana	RING-H2 finger protein ATL29	42.321%	Swiss-Prot	weak database homology
`Q9FIR0`	Arabidopsis thaliana	RING-H2 finger protein ATL30	42.484%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card