TkA01G028950 | RubberDandelionOmics

Gene overview

TkA01G028950

Reference: TK1151 Chr: Chr01 Coordinates: 7428116-7430773 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1213 bp · TkA01G028950|TK1151|cDNA

CCTTGAATAATTTGACCGTTGCCAAAACAGCTCTTTCTCTCTCCCTCTTTCTTTATTCAAACACCATCATCATCTTCCTGTTGCTGTTGTCCGCCTCTCTCCCTCTCTCATTCTCTCTAAAGAATTTCTCTCATGGCAACAGTGATGGAGACGCATTCTCAGCAAAAGGCATCTACAGAGAAAAAGAGGTGGACACTCAGTGACTTCGACATTGGCAAACCACTAGGAAGGGGAAAATTCGGTCATGTCTATGTAGCAAG...

CDS

Download CDS FASTA

870 bp · TkA01G028950|TK1151|CDS

ATGGCAACAGTGATGGAGACGCATTCTCAGCAAAAGGCATCTACAGAGAAAAAGAGGTGGACACTCAGTGACTTCGACATTGGCAAACCACTAGGAAGGGGAAAATTCGGTCATGTCTATGTAGCAAGAGAAAAAAGGAGCAATCATGTTGTGGCATTGAAAGTTCTTTTCAAAAGCCAACTTAAACAGTCTCAAGTGGAACACCAACTTCGCCGTGAAGTTGAAATTCAAAGCCATCTTAGACACCCTAATATTCTAAG...

Protein

Download Protein FASTA

289 aa · TkA01G028950|TK1151|PROTEIN

MATVMETHSQQKASTEKKRWTLSDFDIGKPLGRGKFGHVYVAREKRSNHVVALKVLFKSQLKQSQVEHQLRREVEIQSHLRHPNILRLYGYFYDQQRVYLILEYAAKGELYKELQKCKCFTERRSATYVASLARALIYCHGKHVIHRDIKPENLLIGSQGELKIADFGWSVHTFNRRRTMCGTLDYLPPEMVESVEHDASVDIWSLGILCYEFLYGAPPFEAEEHSDTYRRIRQVDLKFPAKPVVSAAAKDLISQMLVKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G028950`
TK1151 ID	TkA01G028950
OH-1004 ID	LXL04_025901
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	86.900
Protein coverage (%)	TK1151 99.308 / OH-1004 99.658 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G028950

Location Chr01:7428116-7430773 (-)

Description Similar to AUR1: Serine/threonine-protein kinase Aurora-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32830`	Phosphorylates specifically 'Ser-10' of histone H3 in vitro and colocalizes with phosphorylated histone H3 during mitosis.	Characterization of plant Aurora kinases during mitosis.2005 · DOI: 10.1007/s11103-005-3454-x
`At2g25880`	Phosphorylates specifically 'Ser-10' of histone H3 in vitro.	Characterization of plant Aurora kinases during mitosis.2005 · DOI: 10.1007/s11103-005-3454-x
`At2g45490`	Phosphorylates in vitro histone H3 at 'Ser-10' (H3S10ph) and 'Ser-28' (H3S28ph), but not at 'Thr-3' (H3T3ph) or 'Thr-11' (H3T11ph).	Characterization of plant Aurora kinases during mitosis.2005 · DOI: 10.1007/s11103-005-3454-x Aurora kinase is required for chromosome segregation in tobacco BY-2 cells.2006 · DOI: 10.1111/j.1365-313x.2006.02893.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025901 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000212 meiotic spindle organization Biological Process

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0007051 spindle organization Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0007057 spindle assembly involved in female meiosis I Biological Process

GO:0007098 centrosome cycle Biological Process

GO:0007100 mitotic centrosome separation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009948 anterior/posterior axis specification Biological Process

GO:0010629 negative regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT2G25880

ath:AT2G45490

ath:AT4G32830

bta:504437

mmu:20878

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.587

Rank 1 · TkA01G028950 · TK1151

Nucleus0.551

Rank 2 · TkA01G028950 · TK1151

Cell membrane0.082

Rank 3 · TkA01G028950 · TK1151

Mitochondrion0.058

Rank 4 · TkA01G028950 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA01G028950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03109ABC123-59 aa

PF00069Pkinase26-276 aa

PF07714PK_Tyr_Ser-Thr27-272 aa

PF14531Kinase-like29-72 aa

PF03109ABC197-179 aa

PF07387Seadorna_VP7117-167 aa

PF14531Kinase-like134-219 aa

PF17667Pkinase_fungal142-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G028950	`PF03109`	ABC1	23	59	1.3e-05	25.2
TkA01G028950	`PF00069`	Pkinase	26	276	1.4e-74	251.5
TkA01G028950	`PF07714`	PK_Tyr_Ser-Thr	27	272	2.3e-42	145.8
TkA01G028950	`PF14531`	Kinase-like	29	72	0.003	17.6
TkA01G028950	`PF03109`	ABC1	97	179	1.3e-05	25.2
TkA01G028950	`PF07387`	Seadorna_VP7	117	167	0.3	10.8
TkA01G028950	`PF14531`	Kinase-like	134	219	0.003	17.6
TkA01G028950	`PF17667`	Pkinase_fungal	142	205	0.13	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M077`	Arabidopsis thaliana	sp\|Q9M077\|AUR1_ARATH Serine/threonine-protein kinase Aurora-1	87.400%	Swiss-Prot	High
`Q683C9`	Arabidopsis thaliana	sp\|Q683C9\|AUR2_ARATH Serine/threonine-protein kinase Aurora-2	87.800%	Swiss-Prot	High
`O64629`	Arabidopsis thaliana	sp\|O64629\|AUR3_ARATH Serine/threonine-protein kinase Aurora-3	62.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card