TkA01G027280 | RubberDandelionOmics

Gene overview

TkA01G027280

Reference: TK1151 Chr: Chr01 Coordinates: 7029358-7042617 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

878 bp · TkA01G027280|TK1151|cDNA

GTTTTATTACGACAGGCCTTTCAAAAAAAAATCTATAACTCTAGGGGGTTATATAAAAGTTTTCAAATACTTAACGGGAAAAAAAGCGTGGTTACAGAACGACCACCACAAGCAAAATCTAAAAAGAAAGATATGGCATTCGCCGTGAATTTGGCGCCGTTGCCCCTCCGATCACCGGAAATCACCATCGGCAGCGTTAGCTACCCAAAGTCCATCGCATCTTTCAGCAGAAAGAGACCGACGTTGTCGTTTGCCGTCAG...

CDS

Download CDS FASTA

3036 bp · TkA01G027280|TK1151|CDS

ATGGCGTCCACAACTACCACCGATCCCGAACACCACCACCATACCTTCTCATCCATCGGCAAGGCAGGGAAGTCATCCGGTGAAATCGAGGGCATGGATTTGCCTCTACTCAATGGCTCACGTCACTCAGAGAAGTATTCGGTAGCTGCTGCTGTTTTTCCATTTCTTTTCCCTGCTCTTGGAGGCCTATTGTATGGCTTTGATATCGGTGCCACCTCATCTGCTACAATCAACATAAAGTCACCTACTTTTAGTGGTGT...

Protein

Download Protein FASTA

1011 aa · TkA01G027280|TK1151|PROTEIN

MASTTTTDPEHHHHTFSSIGKAGKSSGEIEGMDLPLLNGSRHSEKYSVAAAVFPFLFPALGGLLYGFDIGATSSATINIKSPTFSGVSWYELSSVQVGLITSGSLYGALLGSILAFSVADFLGRRRELMVSATSYIIGALITTFAPNFAIMVVGRIIYGIGIGLAMHAAPMYIAETAVSHIRGRLISLKEFFIVTGMVLGYVIGSLLVEVKGGWRFMYATSIPFAVAMGIGMWWLPCSPRWILLRAIQGKGDMRDLREQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G027280`
TK1151 ID	TkA01G027280
OH-1004 ID	LXL04_005653
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	81.200
Protein coverage (%)	TK1151 100.000 / OH-1004 90.560 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G027280

Location Chr01:7029358-7042617 (-)

Description Similar to At5g17010: D-xylose-proton symporter-like 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17010`	D-xylose-proton symporter-like 2.	No verified direct reference in this release
`At3g03090`	D-xylose-proton symporter-like 1.	No verified direct reference in this release
`At5g59250`	D-xylose-proton symporter-like 3, chloroplastic.	No verified direct reference in this release
`At3g05150`	Sugar transporter.	No verified direct reference in this release
`At5g27360`	Sugar transporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005653 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0009845 seed germination Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0015755 fructose transmembrane transport Biological Process

GO:1904659 D-glucose transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

KEGG gene cross-reference

ath:AT3G03090

ath:AT5G17010

ath:AT5G59250

bsu:BSU06230

bsu:BSU35830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.262

Rank 1 · TkA01G027280 · TK1151

Cell membrane0.223

Rank 2 · TkA01G027280 · TK1151

Endoplasmic reticulum0.201

Rank 3 · TkA01G027280 · TK1151

Golgi apparatus0.079

Rank 4 · TkA01G027280 · TK1151

Lysosome / Vacuole0.068

Rank 5 · TkA01G027280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083Sugar_tr57-465 aa

PF07690MFS_161-456 aa

PF05631MFS_595-169 aa

PF03137OATP148-235 aa

PF13873Myb_DNA-bind_5489-506 aa

PF13837Myb_DNA-bind_4497-569 aa

PF13873Myb_DNA-bind_5528-566 aa

PF00111Fer2944-992 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G027280	`PF00083`	Sugar_tr	57	465	2.6e-86	291.0
TkA01G027280	`PF07690`	MFS_1	61	456	3.6e-27	95.9
TkA01G027280	`PF05631`	MFS_5	95	169	1.5e-05	24.8
TkA01G027280	`PF03137`	OATP	148	235	0.002	17.2
TkA01G027280	`PF13873`	Myb_DNA-bind_5	489	506	0.0016	19.1
TkA01G027280	`PF13837`	Myb_DNA-bind_4	497	569	5.8e-07	30.5
TkA01G027280	`PF13873`	Myb_DNA-bind_5	528	566	0.0016	19.1
TkA01G027280	`PF00111`	Fer2	944	992	4e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AWX0`	Arabidopsis thaliana	sp\|Q6AWX0\|XYLL2_ARATH D-xylose-proton symporter-like 2	72.400%	Swiss-Prot	High
`Q8L6Z8`	Arabidopsis thaliana	sp\|Q8L6Z8\|XYLL1_ARATH D-xylose-proton symporter-like 1	68.500%	Swiss-Prot	High
`Q0WWW9`	Arabidopsis thaliana	sp\|Q0WWW9\|XYLL3_ARATH D-xylose-proton symporter-like 3, chloroplastic	61.700%	Swiss-Prot	High
`Q0WQ63`	Arabidopsis thaliana	sp\|Q0WQ63\|ERDL8_ARATH Sugar transporter ERD6-like 8	32.700%	Swiss-Prot	Medium
`Q94CI6`	Arabidopsis thaliana	sp\|Q94CI6\|EDL18_ARATH Sugar transporter ERD6-like 18	35.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card