LXL04_005653 | RubberDandelionOmics

Gene overview

LXL04_005653

Reference: OH-1004 Chr: Chr01 Coordinates: 170154219-170169143 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3797 bp · LXL04_005653|LXL04_005653|OH1004|cDNA

atgggagctgatttgtacacaacatcttttctccatacacaacaaTTGATGCATCATGGGGTTGTACTGTATAACTCTGTAAAGCTTAAATTGTTGTGTACGGAGAAAtattgttgtgtacaaatcagctcccttaGAAAATCGAACAAGACCATCCGCGTGATGGCAAGCACGGCTCACGGCATGGATAGACATACACTTCCCACACATCCATTGACCAAAAACCTTCAAAATCCACGTGGTAATGACGATATTGCCCT...

CDS

Download CDS FASTA

3753 bp · LXL04_005653|LXL04_005653|OH1004|CDS

ATGGGAGCTGATTTGTACACAACATCTTTTCTCCATACACAACAATTGATGCATCATGGGGTTGTACTGTATAACTCTGTAAAGCTTAAATTGTTGTGTACGGAGAAATATTGTTGTGTACAAATCAGCTCCCTTAGAAAATCGAACAAGACCATCCGCGTGATGGCAAGCACGGCTCACGGCATGGATAGACATACACTTCCCACACATCCATTGACCAAAAACCTTCAAAATCCACGTGGTAATGACGATATTGCCCT...

Protein

Download Protein FASTA

1250 aa · LXL04_005653|LXL04_005653|OH1004|PROTEIN

MGADLYTTSFLHTQQLMHHGVVLYNSVKLKLLCTEKYCCVQISSLRKSNKTIRVMASTAHGMDRHTLPTHPLTKNLQNPRGNDDIALLKALFLLFDNLYSTIHLVTKIPVSATTCSIAMASTTTTDPEHHHHTFSSIGKAGKSSGEIEGMDLPLLNGSRHSEKYSVAAAVFPFLFPALGGLLYGFDIGATSSATINIKSPTFSGVSWYELSSVQVGLITSGSLYGALLGSILAFSVADFLGRRRELMVSATSYIIGALIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005653`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005653

Location Chr01:170154219-170169143 (+)

Description Similar to At5g17010: D-xylose-proton symporter-like 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17010`	D-xylose-proton symporter-like 2.	No verified direct reference in this release
`At3g03090`	D-xylose-proton symporter-like 1.	No verified direct reference in this release
`At5g59250`	D-xylose-proton symporter-like 3, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005653 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0009845 seed germination Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0015755 fructose transmembrane transport Biological Process

GO:1904659 D-glucose transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

KEGG gene cross-reference

ath:AT3G03090

ath:AT5G17010

ath:AT5G59250

bsu:BSU06230

bsu:BSU35830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.654

Rank 1 · LXL04_005653 · OH-1004

Cell membrane0.122

Rank 2 · LXL04_005653 · OH-1004

Endoplasmic reticulum0.108

Rank 3 · LXL04_005653 · OH-1004

Cytoplasm0.040

Rank 4 · LXL04_005653 · OH-1004

Nucleus0.039

Rank 5 · LXL04_005653 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083.31Sugar_tr175-604 aa

PF07690.22MFS_1179-574 aa

PF13837.13Myb_DNA-bind_4746-818 aa

PF00111.33Fer21183-1231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005653	`PF00083.31`	Sugar_tr	175	604	2.6e-89	300.9
LXL04_005653	`PF07690.22`	MFS_1	179	574	1.2e-25	90.9
LXL04_005653	`PF13837.13`	Myb_DNA-bind_4	746	818	7e-06	27.1
LXL04_005653	`PF00111.33`	Fer2	1183	1231	2.3e-08	34.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AWX0`	Arabidopsis thaliana	D-xylose-proton symporter-like 2	69.583%	Swiss-Prot	weak database homology
`Q8L6Z8`	Arabidopsis thaliana	D-xylose-proton symporter-like 1	67.146%	Swiss-Prot	weak database homology
`Q0WWW9`	Arabidopsis thaliana	D-xylose-proton symporter-like 3, chloroplastic	57.143%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card