LXL04_038761 | RubberDandelionOmics

Gene overview

LXL04_038761

Reference: OH-1004 Chr: Chr09 Coordinates: 49887925-49889543 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1392 bp · LXL04_038761|LXL04_038761|OH1004|cDNA

ATGGGGAAGTCGAACCCATTCTCGTTTCGCCGGAACAGCAGTAGCAGCAGCACAACCAGGCGTCGCCGGACGACATCGAAGAAGGTAGGCGAGTCACCGTTACTTTTGTCGCAAGCCAACACGCCATCTCCTTCGTCACCCGCTAACGCCGGTGATGTTGTGGCGGCGACCGGAAGCGGGAAACCAATGGGATCTTTGGTGGCGAAACCGAAGAAAAAGGCCGGTGGAGCGAGGTTGTGGATGCGGTTCGATAGGTCTGG...

CDS

Download CDS FASTA

1392 bp · LXL04_038761|LXL04_038761|OH1004|CDS

ATGGGGAAGTCGAACCCATTCTCGTTTCGCCGGAACAGCAGTAGCAGCAGCACAACCAGGCGTCGCCGGACGACATCGAAGAAGGTAGGCGAGTCACCGTTACTTTTGTCGCAAGCCAACACGCCATCTCCTTCGTCACCCGCTAACGCCGGTGATGTTGTGGCGGCGACCGGAAGCGGGAAACCAATGGGATCTTTGGTGGCGAAACCGAAGAAAAAGGCCGGTGGAGCGAGGTTGTGGATGCGGTTCGATAGGTCTGG...

Protein

Download Protein FASTA

463 aa · LXL04_038761|LXL04_038761|OH1004|PROTEIN

MGKSNPFSFRRNSSSSSTTRRRRTTSKKVGESPLLLSQANTPSPSSPANAGDVVAATGSGKPMGSLVAKPKKKAGGARLWMRFDRSGESELFECDKNTIIKRAGIPARDLRILGPIFSNSSNILARERAMVVNLEYIKAIVTAEEVLLLDPLRQEVLPFVDQLRHQLSHKNHFNTSGPQGGRQLALRDTESNLSASGRWQPVPETSEGLQAELPFEFQVLEIALEVVCTYLDSSVADLERDAYPVLDELAKNVSTKNLER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038761`
TK1151 ID	TkA04G462720
OH-1004 ID	LXL04_038761
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038761

Location Chr09:49887925-49889543 (+)

Description Similar to MRS2-4: Magnesium transporter MRS2-4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58970`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`At4g28580`	Magnesium transporter that mediates the influx/efflux of magnesium in a concentration-dependent manner.	A mitochondrial magnesium transporter functions in Arabidopsis pollen development.2008 · DOI: 10.1093/mp/ssn031

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0545000`	Putative magnesium transporter.	No verified direct reference in this release
`UniProt: A2Z9W7`	Putative magnesium transporter.	No verified direct reference in this release
`UniProt: A2XCA0`	Putative magnesium transporter.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038761 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0015693 magnesium ion transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0015095 magnesium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G58970

ath:AT4G28580

dosa:Os10g0545000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.535

Rank 1 · LXL04_038761 · OH-1004

Lysosome / Vacuole0.129

Rank 2 · LXL04_038761 · OH-1004

Cytoplasm0.126

Rank 3 · LXL04_038761 · OH-1004

Endoplasmic reticulum0.113

Rank 4 · LXL04_038761 · OH-1004

Golgi apparatus0.090

Rank 5 · LXL04_038761 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22099.2MRS2-like92-305 aa

PF22099.2MRS2-like338-391 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038761	`PF22099.2`	MRS2-like	92	305	1.5e-32	113.5
LXL04_038761	`PF22099.2`	MRS2-like	338	391	1.5e-32	113.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93ZD7`	Arabidopsis thaliana	Magnesium transporter MRS2-4	65.171%	Swiss-Prot	strong database homology
`Q1PE39`	Arabidopsis thaliana	Magnesium transporter MRS2-6, mitochondrial	51.269%	Swiss-Prot	strong database homology
`A3BV82`	Oryza sativa subsp. japonica	Putative magnesium transporter MRS2-G	62.469%	Swiss-Prot	strong database homology
`A2Z9W7`	Oryza sativa subsp. indica	Putative magnesium transporter MRS2-G	62.469%	Swiss-Prot	strong database homology
`A2XCA0`	Oryza sativa subsp. indica	Putative magnesium transporter MRS2-H	49.628%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card