LXL04_037300 | RubberDandelionOmics

Gene overview

LXL04_037300

Reference: OH-1004 Chr: Chr09 Coordinates: 5542834-5544560 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1305 bp · LXL04_037300|LXL04_037300|OH1004|cDNA

ATGGCCACACAAACGCTTCTTCAGTTCGCCACCAGCGTAACCCAGCTACCATCTTCTTCCTCAATCTCCACATGCCGTCCGCTTTCTCCCTTCTTTTTGAAAGCATGTGATTCAGCTAGGTCTCGGCCACGTCGGCGCTCCGCCGTATGCTGTTCTTTTAGCTCAATGGAGTCTGCAAAGATTAAGGTTGTGGGTGTCGGCGGCGGCGGCAACAATGCTGTTAACCGCATGATTGGTAGCGGGTTGCAGGGTGTTGATTT...

CDS

Download CDS FASTA

1305 bp · LXL04_037300|LXL04_037300|OH1004|CDS

ATGGCCACACAAACGCTTCTTCAGTTCGCCACCAGCGTAACCCAGCTACCATCTTCTTCCTCAATCTCCACATGCCGTCCGCTTTCTCCCTTCTTTTTGAAAGCATGTGATTCAGCTAGGTCTCGGCCACGTCGGCGCTCCGCCGTATGCTGTTCTTTTAGCTCAATGGAGTCTGCAAAGATTAAGGTTGTGGGTGTCGGCGGCGGCGGCAACAATGCTGTTAACCGCATGATTGGTAGCGGGTTGCAGGGTGTTGATTT...

Protein

Download Protein FASTA

434 aa · LXL04_037300|LXL04_037300|OH1004|PROTEIN

MATQTLLQFATSVTQLPSSSSISTCRPLSPFFLKACDSARSRPRRRSAVCCSFSSMESAKIKVVGVGGGGNNAVNRMIGSGLQGVDFYAINTDSQALLQSVAENPIQIGELLTRGLGTGGNPMLGEQAAEESKEAIGNALKGSDLVFITAGMGGGTGSGAAPVVAQIAKEAGYLTVGVVTYPFSFEGRKRSVQAGDWISLCYKRFKYHFFFKYTSLFQALEAIEKLQKNVDTLIVIPNDRLLDIADEQTPLQDAFLLADD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037300`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037300

Location Chr09:5542834-5544560 (-)

Description Similar to FTSZ1: Cell division protein FtsZ homolog 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55280`	Exhibits GTPase activity.	Chloroplast division and morphology are differentially affected by overexpression of FtsZ1 and FtsZ2 genes in Arabidopsis.2000 · DOI: 10.1104/pp.124.4.1668 Effects of mutations in Arabidopsis FtsZ1 on plastid division, FtsZ ring formation and positioning, and FtsZ filament morphology in vivo.2007 · DOI: 10.1093/pcp/pcm049 Developmentally regulated association of plastid division protein FtsZ1 with thylakoid membranes in Arabidopsis thaliana.2008 · DOI: 10.1042/bj20070543 Plant FtsZ1 and FtsZ2 expressed in a eukaryotic host: GTPase activity and self-assembly.2010 · DOI: 10.1016/j.febslet.2009.11.044 FtsZ1/FtsZ2 Turnover in Chloroplasts and the Role of ARC3.2015 · DOI: 10.1017/s1431927615000082 The Arabidopsis minE mutation causes new plastid and FtsZ1 localization phenotypes in the leaf epidermis.2015 · DOI: 10.3389/fpls.2015.00823 Differential impacts of FtsZ proteins on plastid division in the shoot apex of Arabidopsis.2018 · DOI: 10.1016/j.ydbio.2018.06.010 Chloroplast division in higher plants requires members of two functionally divergent gene families with homology to bacterial ftsZ.1998 · DOI: 10.1105/tpc.10.12.1991
`At3g52750`	Exhibits GTPase activity (By similarity).	Arabidopsis FtsZ2-1 and FtsZ2-2 are functionally redundant, but FtsZ-based plastid division is not essential for chloroplast partitioning or plant growth and development.2009 · DOI: 10.1093/mp/ssp077 Differential impacts of FtsZ proteins on plastid division in the shoot apex of Arabidopsis.2018 · DOI: 10.1016/j.ydbio.2018.06.010

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037300 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007017 microtubule-based process Biological Process

GO:0009612 response to mechanical stimulus Biological Process

GO:0009637 response to blue light Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009902 chloroplast relocation Biological Process

GO:0010020 chloroplast fission Biological Process

GO:0032506 cytokinetic process Biological Process

GO:0043093 FtsZ-dependent cytokinesis Biological Process

GO:0043572 plastid fission Biological Process

GO:0051258 protein polymerization Biological Process

GO:0051301 cell division Biological Process

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ana:alr3858

ath:AT3G52750

ath:AT5G55280

bha:BH2558

syn:sll1633

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · LXL04_037300 · OH-1004

Mitochondrion0.052

Rank 2 · LXL04_037300 · OH-1004

Cytoplasm0.019

Rank 3 · LXL04_037300 · OH-1004

Nucleus0.016

Rank 4 · LXL04_037300 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_037300 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00091.32Tubulin60-216 aa

PF12327.14FtsZ_C294-387 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037300	`PF00091.32`	Tubulin	60	216	3.1e-45	155.5
LXL04_037300	`PF12327.14`	FtsZ_C	294	387	2.1e-30	105.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42545`	Arabidopsis thaliana	Cell division protein FtsZ homolog 1, chloroplastic	77.700%	Swiss-Prot	strong database homology
`Q9LXJ0`	Arabidopsis thaliana	Cell division protein FtsZ homolog 2-2, chloroplastic	53.117%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card