LXL04_036270 | RubberDandelionOmics

Gene overview

LXL04_036270

Reference: OH-1004 Chr: Chr08 Coordinates: 39091410-39095035 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2052 bp · LXL04_036270|LXL04_036270|OH1004|cDNA

ATGGAGATGGCGGTCGGAATACACAATTATGTCACTCCCACGCTTAACCCTAATCACAGAAACTCCTCTTTTTCTTCGTCTATCCTCAGAACCCAACTTCCAGTTGGTCGCACCttatcttctttttcttcttccaCCATCAAGTCTCCATCCTTTTCTCATTCGAGAAGAAACCCACTTCACAGTTTCATCAAGTGCTCTGTTTCTGAAGCTGAGGCAACTGAAACTGTCACTGAGAAAAAAGTTGCATTAGTGAGGAG...

CDS

Download CDS FASTA

2052 bp · LXL04_036270|LXL04_036270|OH1004|CDS

ATGGAGATGGCGGTCGGAATACACAATTATGTCACTCCCACGCTTAACCCTAATCACAGAAACTCCTCTTTTTCTTCGTCTATCCTCAGAACCCAACTTCCAGTTGGTCGCACCTTATCTTCTTTTTCTTCTTCCACCATCAAGTCTCCATCCTTTTCTCATTCGAGAAGAAACCCACTTCACAGTTTCATCAAGTGCTCTGTTTCTGAAGCTGAGGCAACTGAAACTGTCACTGAGAAAAAAGTTGCATTAGTGAGGAG...

Protein

Download Protein FASTA

683 aa · LXL04_036270|LXL04_036270|OH1004|PROTEIN

MEMAVGIHNYVTPTLNPNHRNSSFSSSILRTQLPVGRTLSSFSSSTIKSPSFSHSRRNPLHSFIKCSVSEAEATETVTEKKVALVRRNDIRNIAIVAHVDHGKTTLVDAMLKQAKVFRDNQVVEERIMDSNDLERERGITILSKNTSITYKDTKMNIIDTPGHSDFGGEVERVLNMVEGIILVVDSVEGPMPQTRFVLKKALEFGHAVVVVVNKIDRPSARPEFVINSTFELFIELNASDEQCDFQAVYASGIKGMAGLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036270`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036270

Location Chr08:39091410-39095035 (-)

Description Similar to SVR3: Putative elongation factor TypA-like SVR3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13650`	Putative chloroplastic elongation factor involved in response to chilling stress.	A var2 leaf variegation suppressor locus, SUPPRESSOR OF VARIEGATION3, encodes a putative chloroplast translation elongation factor that is important for chloroplast development in the cold.2010 · DOI: 10.1186/1471-2229-10-287

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036270 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000027 ribosomal large subunit assembly Biological Process

GO:0000302 response to reactive oxygen species Biological Process

GO:0006364 rRNA processing Biological Process

GO:0009409 response to cold Biological Process

GO:0010467 gene expression Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0031425 chloroplast RNA processing Biological Process

GO:0032790 ribosome disassembly Biological Process

GO:0050821 protein stabilization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G13650

bsu:BSU14770

sfl:SF3941

sfx:S3805

stm:STM4009

syn:slr1105

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.934

Rank 1 · LXL04_036270 · OH-1004

Mitochondrion0.096

Rank 2 · LXL04_036270 · OH-1004

Cytoplasm0.023

Rank 3 · LXL04_036270 · OH-1004

Nucleus0.020

Rank 4 · LXL04_036270 · OH-1004

Peroxisome0.013

Rank 5 · LXL04_036270 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009.34GTP_EFTU89-280 aa

PF01926.30MMR_HSR193-214 aa

PF22042.3EF-G_D2291-374 aa

PF03144.32GTP_EFTU_D2304-374 aa

PF00679.31EFG_C480-566 aa

PF21018.3BipA_C571-674 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036270	`PF00009.34`	GTP_EFTU	89	280	2.6e-53	181.1
LXL04_036270	`PF01926.30`	MMR_HSR1	93	214	5.8e-06	27.1
LXL04_036270	`PF22042.3`	EF-G_D2	291	374	3e-09	37.6
LXL04_036270	`PF03144.32`	GTP_EFTU_D2	304	374	7.8e-11	43.0
LXL04_036270	`PF00679.31`	EFG_C	480	566	5e-20	72.1
LXL04_036270	`PF21018.3`	BipA_C	571	674	1.3e-39	135.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K410`	Arabidopsis thaliana	Putative elongation factor TypA-like SVR3, chloroplastic	78.743%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card