LXL04_036164 | RubberDandelionOmics

Gene overview

LXL04_036164

Reference: OH-1004 Chr: Chr08 Coordinates: 37392309-37397009 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2304 bp · LXL04_036164|LXL04_036164|OH1004|cDNA

ATGAATGAACTAGAAGCATGCAACTGGTCACAAGGGTTTGAAGATGATCTTCTAAGAGAGCTTCTTTACGACGAATCCCCATATCTTCTTTTGCCTCAAAAAATCGCTAGTGATTCATTAGACAATCACTCGGTAAACAATTTGATATCAAGCATATATTCTGGCCCCACAATAACGGATTTTGAAAAAGCACTAGAGGCTTCAAGTGACACAAATAATAATACTCCTGATTTTTCAGCATTGACCAGAATTGCAGATAT...

CDS

Download CDS FASTA

2304 bp · LXL04_036164|LXL04_036164|OH1004|CDS

ATGAATGAACTAGAAGCATGCAACTGGTCACAAGGGTTTGAAGATGATCTTCTAAGAGAGCTTCTTTACGACGAATCCCCATATCTTCTTTTGCCTCAAAAAATCGCTAGTGATTCATTAGACAATCACTCGGTAAACAATTTGATATCAAGCATATATTCTGGCCCCACAATAACGGATTTTGAAAAAGCACTAGAGGCTTCAAGTGACACAAATAATAATACTCCTGATTTTTCAGCATTGACCAGAATTGCAGATAT...

Protein

Download Protein FASTA

767 aa · LXL04_036164|LXL04_036164|OH1004|PROTEIN

MNELEACNWSQGFEDDLLRELLYDESPYLLLPQKIASDSLDNHSVNNLISSIYSGPTITDFEKALEASSDTNNNTPDFSALTRIADMERGVPRVENKYVLKIKCSGNVMADDGYKWRKYGQKSIKNSSNPRSYYKCTNPRCGAKKQVERSSEDHETLIITYEGLHLHYMYPFFIFGQSENLDPPTKKFRTLNFEPGAHQNYKQPTIDMDENIGHVSHDLPSTMLRDYQEGLPEEVPINSQVKLKSIIEITWRITWFTASF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036164`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036164

Location Chr08:37392309-37397009 (+)

Description Similar to WRKY49: Probable WRKY transcription factor 49

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g43290`	Transcription factor.	No verified direct reference in this release
`At2g04880`	Transcription factor.	Characterization of a zinc-dependent transcriptional activator from Arabidopsis.1996 · DOI: 10.1093/nar/24.23.4624
`At1g69310`	Transcription factor.	No verified direct reference in this release
`At5g13080`	Transcription factor.	No verified direct reference in this release
`At2g46130`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036164 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0010055 atrichoblast differentiation Biological Process

GO:0032107 regulation of response to nutrient levels Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048527 lateral root development Biological Process

KEGG gene cross-reference

ath:AT1G69310

ath:AT2G04880

ath:AT5G13080

ath:AT5G43290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.956

Rank 1 · LXL04_036164 · OH-1004

Cytoplasm0.103

Rank 2 · LXL04_036164 · OH-1004

Cell membrane0.027

Rank 3 · LXL04_036164 · OH-1004

Endoplasmic reticulum0.017

Rank 4 · LXL04_036164 · OH-1004

Mitochondrion0.012

Rank 5 · LXL04_036164 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY111-167 aa

PF26130.1PB1-like285-383 aa

PF03108.21DBD_Tnp_Mut474-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036164	`PF03106.22`	WRKY	111	167	1.8e-24	86.4
LXL04_036164	`PF26130.1`	PB1-like	285	383	9.2e-06	26.6
LXL04_036164	`PF03108.21`	DBD_Tnp_Mut	474	539	9.8e-10	38.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FHR7`	Arabidopsis thaliana	Probable WRKY transcription factor 49	44.022%	Swiss-Prot	weak database homology
`Q9SI37`	Arabidopsis thaliana	WRKY transcription factor 1	55.405%	Swiss-Prot	weak database homology
`Q9C983`	Arabidopsis thaliana	Probable WRKY transcription factor 57	57.534%	Swiss-Prot	weak database homology
`Q9FYA2`	Arabidopsis thaliana	Probable WRKY transcription factor 75	49.296%	Swiss-Prot	weak database homology
`Q8GY11`	Arabidopsis thaliana	Probable WRKY transcription factor 43	45.238%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card