LXL04_033419 | RubberDandelionOmics

Gene overview

LXL04_033419

Reference: OH-1004 Chr: Chr07 Coordinates: 43362432-43367272 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2790 bp · LXL04_033419|LXL04_033419|OH1004|cDNA

ATGATACCCTATAAACAATATATTATAAGTAAATTTGGAGACCGATTCATTTTAGTGGGATCTTCCGATCCGATTCGATCTTACGATCACGATCTTAAAACTAACAAAACGATATTAGGTAGGATCCCGACTTTGACAACCTTGACACAAACTTTAAAAACCCATTTTCACTATCTTCCATTATCAAGATTAACAAAATATATTTACGTATTATCTGTTGACTTCCGTTCTTTCCAAAGAAACGTCAGAGTCTTCGCGAT...

CDS

Download CDS FASTA

2790 bp · LXL04_033419|LXL04_033419|OH1004|CDS

ATGATACCCTATAAACAATATATTATAAGTAAATTTGGAGACCGATTCATTTTAGTGGGATCTTCCGATCCGATTCGATCTTACGATCACGATCTTAAAACTAACAAAACGATATTAGGTAGGATCCCGACTTTGACAACCTTGACACAAACTTTAAAAACCCATTTTCACTATCTTCCATTATCAAGATTAACAAAATATATTTACGTATTATCTGTTGACTTCCGTTCTTTCCAAAGAAACGTCAGAGTCTTCGCGAT...

Protein

Download Protein FASTA

929 aa · LXL04_033419|LXL04_033419|OH1004|PROTEIN

MIPYKQYIISKFGDRFILVGSSDPIRSYDHDLKTNKTILGRIPTLTTLTQTLKTHFHYLPLSRLTKYIYVLSVDFRSFQRNVRVFAIGALLKTMENREDLNSVLEFLPVILRSSALFWPSHVVEVLKALSQGPRYSKVDSGEALFITISKLRTSLNLSSDAVASSTADGYSLFFDDLLSRAEADKWFAEILPALADSLLRLPSMLEAHYQSADSITCVGARAGLKTGLRLLKSQETGIVLLSQELIGALLACSFFCLFPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033419`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033419

Location Chr07:43362432-43367272 (-)

Description Similar to PARG1: Poly(ADP-ribose) glycohydrolase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31870`	Poly(ADP-ribose) synthesized after DNA damage is only present transiently and is rapidly degraded by poly(ADP-ribose) glycohydrolase (By similarity).	No verified direct reference in this release
`At2g31865`	Poly(ADP-ribose) synthesized after DNA damage is only present transiently and is rapidly degraded by poly(ADP-ribose) glycohydrolase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033419 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006282 regulation of DNA repair Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0006974 DNA damage response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009225 nucleotide-sugar metabolic process Biological Process

GO:0009408 response to heat Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0030576 Cajal body organization Biological Process

GO:0031507 heterochromatin formation Biological Process

GO:0036099 female germ-line stem cell population maintenance Biological Process

GO:0043484 regulation of RNA splicing Biological Process

KEGG gene cross-reference

ath:AT2G31865

ath:AT2G31870

dme:Dmel_CG2864

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.595

Rank 1 · LXL04_033419 · OH-1004

Nucleus0.281

Rank 2 · LXL04_033419 · OH-1004

Cell membrane0.110

Rank 3 · LXL04_033419 · OH-1004

Mitochondrion0.094

Rank 4 · LXL04_033419 · OH-1004

Endoplasmic reticulum0.065

Rank 5 · LXL04_033419 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20811.3PARG_cat_N179-316 aa

PF05028.21PARG_cat_C334-555 aa

PF20811.3PARG_cat_N711-847 aa

PF05028.21PARG_cat_C866-913 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033419	`PF20811.3`	PARG_cat_N	179	316	1.7e-74	248.3
LXL04_033419	`PF05028.21`	PARG_cat_C	334	555	4.9e-93	311.2
LXL04_033419	`PF20811.3`	PARG_cat_N	711	847	1.7e-74	248.3
LXL04_033419	`PF05028.21`	PARG_cat_C	866	913	4.9e-93	311.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SKB3`	Arabidopsis thaliana	Poly(ADP-ribose) glycohydrolase 1	53.539%	Swiss-Prot	moderate database homology
`Q8VYA1`	Arabidopsis thaliana	Probable poly(ADP-ribose) glycohydrolase 2	52.299%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card