LXL04_033315 | RubberDandelionOmics

Gene overview

LXL04_033315

Reference: OH-1004 Chr: Chr07 Coordinates: 40738229-40741355 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

930 bp · LXL04_033315|LXL04_033315|OH1004|cDNA

ATGGGACGAATCACCAACAAAATGAGTAGAGATTTCGGTATCAATGGATATAATGTTTGTACTTGCTGTCTGTTGAAGAAAATCGCCCCTATGGCGGACCAGAAACAGCAAGAATCCATCAATCCATGGGGTTTAAAATCATGGACATACCTCTCATCTCTCCGGCAACATTCGCCGTTAATACAATGCATCACCAACTTCGTATCAATGGATATAATGGCCAATACCCTCTTAGCCGCCGGTGCATCACCGGCGATGGT...

CDS

Download CDS FASTA

930 bp · LXL04_033315|LXL04_033315|OH1004|CDS

ATGGGACGAATCACCAACAAAATGAGTAGAGATTTCGGTATCAATGGATATAATGTTTGTACTTGCTGTCTGTTGAAGAAAATCGCCCCTATGGCGGACCAGAAACAGCAAGAATCCATCAATCCATGGGGTTTAAAATCATGGACATACCTCTCATCTCTCCGGCAACATTCGCCGTTAATACAATGCATCACCAACTTCGTATCAATGGATATAATGGCCAATACCCTCTTAGCCGCCGGTGCATCACCGGCGATGGT...

Protein

Download Protein FASTA

309 aa · LXL04_033315|LXL04_033315|OH1004|PROTEIN

MGRITNKMSRDFGINGYNVCTCCLLKKIAPMADQKQQESINPWGLKSWTYLSSLRQHSPLIQCITNFVSMDIMANTLLAAGASPAMVHSILEIPDFTPHTQSVLINVGTLTPDWLPAMKAAAGVANQLGKPWVLDPAAVGASSFRLKACLELIELKPTVIRGNGSEIIALSMASIGSTKGADSLHESKDAVESAKSLAKSSGSIVAISGSVDFVTDGERVVGAHNGVPMMQKITASGCAVTALIAAFVAVDPTHAFEATA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033315`
TK1151 ID	TkA08G250360
OH-1004 ID	LXL04_033315
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033315

Location Chr07:40738229-40741355 (+)

Description Similar to THIM: Hydroxyethylthiazole kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24030`	Thiazole kinase involved in thiamine salvage pathway.	Identification of the thiamin salvage enzyme thiazole kinase in Arabidopsis and maize.2013 · DOI: 10.1016/j.phytochem.2013.05.017

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033315 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009228 thiamine biosynthetic process Biological Process

GO:0009229 thiamine diphosphate biosynthetic process Biological Process

GO:0036172 thiamine salvage Biological Process

GO:0000287 magnesium ion binding Molecular Function

GO:0004417 hydroxyethylthiazole kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G24030

rsh:Rsph17029_2302

rsk:RSKD131_2006

rsp:RSP_0649

zma:103635163

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.577

Rank 1 · LXL04_033315 · OH-1004

Nucleus0.231

Rank 2 · LXL04_033315 · OH-1004

Mitochondrion0.201

Rank 3 · LXL04_033315 · OH-1004

Peroxisome0.099

Rank 4 · LXL04_033315 · OH-1004

Plastid0.088

Rank 5 · LXL04_033315 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02110.21HK51-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033315	`PF02110.21`	HK	51	296	1.7e-71	241.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIQ4`	Arabidopsis thaliana	Hydroxyethylthiazole kinase	67.910%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card