LXL04_033077 | RubberDandelionOmics

Gene overview

LXL04_033077

Reference: OH-1004 Chr: Chr07 Coordinates: 35477713-35480988 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1890 bp · LXL04_033077|LXL04_033077|OH1004|cDNA

ATGGGCTTGTTTCTGGAGATGGCCATTTGGAAGACGTATCTAACGATTTCTTCCACCAAAATGATTTACGACCGGTTACTGTACACAACCGGTTGTCAACCGGAGGGGCAAAAGGAGTGCGACCGCATCGTCCATGGCAGCAGATTGACCTGCAACTCCAAAGTCCAACTTCGGCTGATACACCAATGGGCGAACACGATTTCCGATTGCCATGAGCCTTCTCCTTTCCGATCATTATCAGTCAACGCCGCCATGATCAA...

CDS

Download CDS FASTA

1878 bp · LXL04_033077|LXL04_033077|OH1004|CDS

ATGGGCTTGTTTCTGGAGATGGCCATTTGGAAGACGTATCTAACGATTTCTTCCACCAAAATGATTTACGACCGGTTACTGTACACAACCGGTTGTCAACCGGAGGGGCAAAAGGAGTGCGACCGCATCGTCCATGGCAGCAGATTGACCTGCAACTCCAAAGTCCAACTTCGGCTGATACACCAATGGGCGAACACGATTTCCGATTGCCATGAGCCTTCTCCTTTCCGATCATTATCAGTCAACGCCGCCATGATCAA...

Protein

Download Protein FASTA

625 aa · LXL04_033077|LXL04_033077|OH1004|PROTEIN

MGLFLEMAIWKTYLTISSTKMIYDRLLYTTGCQPEGQKECDRIVHGSRLTCNSKVQLRLIHQWANTISDCHEPSPFRSLSVNAAMINTTAASTSTNTASQPSASSSSNTAAQSLGLKNFFKTPEGRYKLHQDKTHPSSLLPYALAKSITQITLAQIKDQPVHATTSTPPLQPNSSYSVASSGVRYVTSKFLGSSGNGSRMLGFVGGNGTGSKANGGTSKSSHVGGLTNGVNFTPGSSTPDGKGTFLIFNVGDTLYISELN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033077`
TK1151 ID	TkA08G229020
OH-1004 ID	LXL04_033077
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 86.560 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_033077`
Location	Chr07:35477713-35480988 (-)
Description	Similar to Dmwd: Dystrophia myotonica WD repeat-containing protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033077` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0045013 carbon catabolite repression of transcription Biological Process GO:2000059 negative regulation of ubiquitin-dependent protein catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0032153 cell division site Cellular Component GO:0051286 cell tip Cellular Component GO:1905368 peptidase complex Cellular Component GO:0035800 deubiquitinase activator activity Molecular Function
KEGG gene cross-reference	act:ACLA_082740 ang:An11g02750 mmu:13401 nfi:NFIA_053550 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.507

Rank 1 · LXL04_033077 · OH-1004

Nucleus0.384

Rank 2 · LXL04_033077 · OH-1004

Lysosome / Vacuole0.113

Rank 3 · LXL04_033077 · OH-1004

Cell membrane0.096

Rank 4 · LXL04_033077 · OH-1004

Golgi apparatus0.087

Rank 5 · LXL04_033077 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24807.2WD40_CDC20-Fz249-428 aa

PF25460.2Beta-prop_Aladin381-476 aa

PF23414.2Beta-prop_EML_2384-470 aa

PF24796.2WDR55389-481 aa

PF24805.2EIF3I389-427 aa

PF25047.1Beta-prop_TEP1_2nd392-487 aa

PF25171.2Beta-prop_WDR36-Utp21_1st392-467 aa

PF00400.39WD40396-424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033077	`PF24807.2`	WD40_CDC20-Fz	249	428	1.3e-11	45.0
LXL04_033077	`PF25460.2`	Beta-prop_Aladin	381	476	1.1e-06	28.7
LXL04_033077	`PF23414.2`	Beta-prop_EML_2	384	470	6.2e-12	46.2
LXL04_033077	`PF24796.2`	WDR55	389	481	3e-09	37.1
LXL04_033077	`PF24805.2`	EIF3I	389	427	1.9e-08	34.6
LXL04_033077	`PF25047.1`	Beta-prop_TEP1_2nd	392	487	4.5e-14	52.9
LXL04_033077	`PF25171.2`	Beta-prop_WDR36-Utp21_1st	392	467	1.6e-06	28.4
LXL04_033077	`PF00400.39`	WD40	396	424	1.4e-18	67.2
LXL04_033077	`PF23381.2`	Beta-prop_IFT122_1st	398	489	4.9e-21	76.0
LXL04_033077	`PF24780.2`	WD40_MABP1-WDR62_1st	398	488	3.8e-07	30.4
LXL04_033077	`PF24782.3`	WD40_MABP1-WDR62_2nd	398	488	4.6e-06	26.5
LXL04_033077	`PF25175.2`	Beta-prop_WDR5	399	489	1.2e-17	64.9
LXL04_033077	`PF25172.2`	Beta-prop_WDR3_2nd	400	469	1.9e-06	28.0
LXL04_033077	`PF23381.2`	Beta-prop_IFT122_1st	440	489	4.9e-21	76.0
LXL04_033077	`PF00400.39`	WD40	441	466	1.4e-18	67.2
LXL04_033077	`PF24814.2`	WD40_Prp19	441	489	3.5e-13	50.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card