RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_033057
Reference: OH-1004 Chr: Chr07 Coordinates: 35180372-35183640 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1890 bp · LXL04_033057|LXL04_033057|OH1004|cDNA

ATGTTTTCTTCAGGGGAAGAACACGACTGATCATCGACAATGACGTCTGATTCAAGCTCCGCATCATTATCCTCTGACGATGAAGAGGAATCAGCCGGCCAAAAACCTAACGTTGACGTTCACACCAATTCGATAGATACCTCCCTAGATGCCATCGAGAATCAGTTGTCTTCGATCGCATTGAACACTTCAATTGACGAAAGAAGTGTATCACCTACTGGTTATCATGAGCCGGTCTCGGAGATCGAAAATGGATCGTT...

CDS

Download CDS FASTA

1851 bp · LXL04_033057|LXL04_033057|OH1004|CDS

ATGACGTCTGATTCAAGCTCCGCATCATTATCCTCTGACGATGAAGAGGAATCAGCCGGCCAAAAACCTAACGTTGACGTTCACACCAATTCGATAGATACCTCCCTAGATGCCATCGAGAATCAGTTGTCTTCGATCGCATTGAACACTTCAATTGACGAAAGAAGTGTATCACCTACTGGTTATCATGAGCCGGTCTCGGAGATCGAAAATGGATCGTTGAGGGAAAGTGTAAGAGAGAGGCGGAGAAACTCGATCGG...

Protein

Download Protein FASTA

616 aa · LXL04_033057|LXL04_033057|OH1004|PROTEIN

MTSDSSSASLSSDDEEESAGQKPNVDVHTNSIDTSLDAIENQLSSIALNTSIDERSVSPTGYHEPVSEIENGSLRESVRERRRNSIGESSSSIGLGLSRNHLEVEVEVEREADGQLASPSSSGYAGERGSSSSPTSASGTDVIRELRDNGSSIGDDGVVSVDPSQTQWIRGKRHADEDDGSISWRKRKKHFFILSHSGKPIYSRYGDEHKLAGFSATLQAIISFVENGGDRVKLVRAGKHQVVFLVKGPIYLVCISCTEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_033057
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_033057
LocationChr07:35180372-35183640 (-)
DescriptionSimilar to MON1: Vacuolar fusion protein MON1 homolog
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g28390 Plays an important role in membrane trafficking through the secretory apparatus.
Activation of the Rab7 GTPase by the MON1-CCZ1 Complex Is Essential for PVC-to-Vacuole Trafficking and Plant Growth in Arabidopsis.2014 · DOI: 10.1105/tpc.114.123141

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0976000 Plays an important role in membrane trafficking through the secretory apparatus. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_033057 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006623 protein targeting to vacuole Biological Process
GO:0006879 intracellular iron ion homeostasis Biological Process
GO:0006886 intracellular protein transport Biological Process
GO:0007033 vacuole organization Biological Process
GO:0009306 protein secretion Biological Process
GO:0015031 protein transport Biological Process
GO:0016192 vesicle-mediated transport Biological Process
GO:0019085 early viral transcription Biological Process
GO:0019086 late viral transcription Biological Process
GO:0045324 late endosome to vacuole transport Biological Process
GO:0099402 plant organ development Biological Process
GO:0005634 nucleus Cellular Component
KEGG gene cross-reference
ath:AT2G28390
dosa:Os01g0976000
mcf:102126726
mmu:270096
mmu:72825
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.478
Rank 1 · LXL04_033057 · OH-1004
Golgi apparatus0.293
Rank 2 · LXL04_033057 · OH-1004
Lysosome / Vacuole0.248
Rank 3 · LXL04_033057 · OH-1004
Nucleus0.220
Rank 4 · LXL04_033057 · OH-1004
Cell membrane0.129
Rank 5 · LXL04_033057 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19036.7Fuz_longin_1189-310 aa
PF19037.7Fuz_longin_2349-425 aa
PF19038.7Fuz_longin_3502-602 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_033057PF19036.7Fuz_longin_11893103.3e-30105.6
LXL04_033057PF19037.7Fuz_longin_23494253.6e-1556.7
LXL04_033057PF19038.7Fuz_longin_35026021.1e-1971.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SKN1Arabidopsis thalianaVacuolar fusion protein MON1 homolog66.981%Swiss-Protstrong database homology
Q5JL08Oryza sativa subsp. japonicaVacuolar fusion protein MON1 homolog65.310%Swiss-Protstrong database homology

JBrowse

View in Genome Browser