LXL04_030368 | RubberDandelionOmics

Gene overview

LXL04_030368

Reference: OH-1004 Chr: Chr06 Coordinates: 114950494-114951464 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

843 bp · LXL04_030368|LXL04_030368|OH1004|cDNA

ATGATGGAGCTTGAAGGTAGCCGCTATTTTCCTATTTCTTTCCTATTTCGATTCAAGTTCTTCAATTTCTTCAAATTCATCCTCGGAAGAATCGCAAAATGGATTGAAATTCTTACGGTGATTGGGGTAATAAGATTAATTTATTCCGTTTCCGATCTCAGGTTCGAAGATGGCGGTGGCGGTGATGGGGGTGATGGGGTGAAtgagaagaagaggaagagcTGTGGTGGCAGTTGGGATGACGTGGATAACCTGAGTTT...

CDS

Download CDS FASTA

843 bp · LXL04_030368|LXL04_030368|OH1004|CDS

ATGATGGAGCTTGAAGGTAGCCGCTATTTTCCTATTTCTTTCCTATTTCGATTCAAGTTCTTCAATTTCTTCAAATTCATCCTCGGAAGAATCGCAAAATGGATTGAAATTCTTACGGTGATTGGGGTAATAAGATTAATTTATTCCGTTTCCGATCTCAGGTTCGAAGATGGCGGTGGCGGTGATGGGGGTGATGGGGTGAATGAGAAGAAGAGGAAGAGCTGTGGTGGCAGTTGGGATGACGTGGATAACCTGAGTTT...

Protein

Download Protein FASTA

280 aa · LXL04_030368|LXL04_030368|OH1004|PROTEIN

MMELEGSRYFPISFLFRFKFFNFFKFILGRIAKWIEILTVIGVIRLIYSVSDLRFEDGGGGDGGDGVNEKKRKSCGGSWDDVDNLSLDGSGLNYDSDDFTVNTTTNFEENGIKINGGNSSNANSTVTGAGGSNQKGKKKGLPAKNLMAERRRRKKLNDRLYMLRSVVPKISKMDRASILGDTIEYLKELLQKINDLNYELESAPSSSSLTPTAGLDGDYLRRNFGPVLDIVPLANTITKLTARCEICGKKTHFTFRKTKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030368`
TK1151 ID	TkA07G400040
OH-1004 ID	LXL04_030368
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030368

Location Chr06:114950494-114951464 (-)

Description Similar to SCRM2: Transcription factor SCREAM2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12860`	Mediates stomatal differentiation in the epidermis probably by controlling successive roles of SPCH, MUTE, and FAMA.	SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At3g26744`	Transcriptional activator that regulates the cold-induced transcription of CBF/DREB1 genes.	SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048397 SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At3g07800`	Part of the salvage pathway for purine and pyrimidine deoxyribonucleotide synthesis.	Two thymidine kinases and one multisubstrate deoxyribonucleoside kinase salvage DNA precursors in Arabidopsis thaliana.2012 · DOI: 10.1111/j.1742-4658.2012.08747.x Arabidopsis thaliana thymidine kinase 1a is ubiquitously expressed during development and contributes to confer tolerance to genotoxic stress.2015 · DOI: 10.1007/s11103-014-0277-7
`At5g23070`	Part of the salvage pathway for purine and pyrimidine deoxyribonucleotide synthesis.	Two thymidine kinases and one multisubstrate deoxyribonucleoside kinase salvage DNA precursors in Arabidopsis thaliana.2012 · DOI: 10.1111/j.1742-4658.2012.08747.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0113100`	Thymidine kinase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030368 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006302 double-strand break repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009960 endosperm development Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010225 response to UV-C Biological Process

GO:0010440 stomatal lineage progression Biological Process

GO:0010444 guard mother cell differentiation Biological Process

KEGG gene cross-reference

ath:AT1G12860

ath:AT3G07800

ath:AT3G26744

ath:AT5G23070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.930

Rank 1 · LXL04_030368 · OH-1004

Cytoplasm0.127

Rank 2 · LXL04_030368 · OH-1004

Cell membrane0.037

Rank 3 · LXL04_030368 · OH-1004

Endoplasmic reticulum0.027

Rank 4 · LXL04_030368 · OH-1004

Mitochondrion0.011

Rank 5 · LXL04_030368 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH147-189 aa

PF23177.2bHLH_IRO3147-198 aa

PF23173.3bHLH_SAC51149-192 aa

PF00265.25TK212-271 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030368	`PF00010.32`	HLH	147	189	1.6e-09	38.2
LXL04_030368	`PF23177.2`	bHLH_IRO3	147	198	3.8e-06	27.9
LXL04_030368	`PF23173.3`	bHLH_SAC51	149	192	6e-06	26.8
LXL04_030368	`PF00265.25`	TK	212	271	1.3e-13	51.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPW3`	Arabidopsis thaliana	Transcription factor SCREAM2	55.333%	Swiss-Prot	moderate database homology
`Q9LSE2`	Arabidopsis thaliana	Transcription factor ICE1	42.986%	Swiss-Prot	moderate database homology
`Q9S750`	Arabidopsis thaliana	Thymidine kinase a	47.475%	Swiss-Prot	weak database homology
`F4KBF5`	Arabidopsis thaliana	Thymidine kinase b	45.455%	Swiss-Prot	weak database homology
`O81263`	Oryza sativa subsp. japonica	Thymidine kinase	56.098%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card