LXL04_029699 | RubberDandelionOmics

Gene overview

LXL04_029699

Reference: OH-1004 Chr: Chr06 Coordinates: 97414491-97416638 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · LXL04_029699|LXL04_029699|OH1004|cDNA

ATGGGTGTCCACATCAATATTCGCGAGCTTCATCACCATAACCGACCTTATGTATTTTTACCGCCAAAATGCTCATCCATCTCCCAACGAAATGTGTGTTTAAAGTTGCCAGTTCGTCTCCAATCCATCTCCCTGCGTGACTGGAGTTCACGATTTGTAGTTCGGAGACACATTTCGAATAATATTGTGAATCAGATTGATCGAAATGAGCCTCAAGAGTACACCCCAATATCATCTCAGAATCCTGAAAAGAAGGCGGC...

CDS

Download CDS FASTA

1236 bp · LXL04_029699|LXL04_029699|OH1004|CDS

ATGGGTGTCCACATCAATATTCGCGAGCTTCATCACCATAACCGACCTTATGTATTTTTACCGCCAAAATGCTCATCCATCTCCCAACGAAATGTGTGTTTAAAGTTGCCAGTTCGTCTCCAATCCATCTCCCTGCGTGACTGGAGTTCACGATTTGTAGTTCGGAGACACATTTCGAATAATATTGTGAATCAGATTGATCGAAATGAGCCTCAAGAGTACACCCCAATATCATCTCAGAATCCTGAAAAGAAGGCGGC...

Protein

Download Protein FASTA

411 aa · LXL04_029699|LXL04_029699|OH1004|PROTEIN

MGVHINIRELHHHNRPYVFLPPKCSSISQRNVCLKLPVRLQSISLRDWSSRFVVRRHISNNIVNQIDRNEPQEYTPISSQNPEKKAASNSILDVLQNANSILPQVVVISTIVAFIHPSSFTWFTSRYYGPALGFLMFAVGLNLREEDFTEAFKSPAPIFCGLFGQFAIKPLLGFLLGTLSTSLFRLPSSLSDGIMLTSCVNGAQLSNYATFLTDPTMAPLSIVMTSLSTASAVFFTPFLSLLLLGKRLNVDVHGMVSNIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029699`
TK1151 ID	TkA07G337490
OH-1004 ID	LXL04_029699
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029699

Location Chr06:97414491-97416638 (+)

Description Similar to BASS6: Probable sodium/metabolite cotransporter BASS6, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22840`	May function as sodium-coupled metabolite transporter across the chloroplast envelope.	No verified direct reference in this release
`At4g12030`	Plastidic transporter involved in the biosynthesis of aliphatic glucosinolates by translocating the biosynthetic intermediates of Met-derived glucosinolates across chloroplast membranes.	The plastidic bile acid transporter 5 is required for the biosynthesis of methionine-derived glucosinolates in Arabidopsis thaliana.2009 · DOI: 10.1105/tpc.109.066399 Arabidopsis bile acid:sodium symporter family protein 5 is involved in methionine-derived glucosinolate biosynthesis.2009 · DOI: 10.1093/pcp/pcp110
`At3g25410`	May function as sodium-coupled metabolite transporter across the chloroplast envelope.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0520600`	May function as sodium-coupled metabolite transporter across the chloroplast envelope.	No verified direct reference in this release
`UniProt: B8BDK4`	May function as sodium-coupled metabolite transporter across the chloroplast envelope.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029699 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0019761 glucosinolate biosynthetic process Biological Process

GO:0033506 glucosinolate biosynthetic process from homomethionine Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

GO:0008028 monocarboxylic acid transmembrane transporter activity Molecular Function

GO:0043879 glycolate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G25410

ath:AT4G12030

ath:AT4G22840

dosa:Os09g0520600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.977

Rank 1 · LXL04_029699 · OH-1004

Mitochondrion0.021

Rank 2 · LXL04_029699 · OH-1004

Cell membrane0.016

Rank 3 · LXL04_029699 · OH-1004

Nucleus0.015

Rank 4 · LXL04_029699 · OH-1004

Endoplasmic reticulum0.013

Rank 5 · LXL04_029699 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01758.22SBF130-313 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029699	`PF01758.22`	SBF	130	313	1.1e-42	146.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYY4`	Arabidopsis thaliana	Probable sodium/metabolite cotransporter BASS6, chloroplastic	57.107%	Swiss-Prot	strong database homology
`F4JPW1`	Arabidopsis thaliana	Probable sodium/metabolite cotransporter BASS5, chloroplastic	58.806%	Swiss-Prot	strong database homology
`Q8RXE8`	Arabidopsis thaliana	Probable sodium/metabolite cotransporter BASS3, chloroplastic	38.871%	Swiss-Prot	moderate database homology
`Q650U0`	Oryza sativa subsp. japonica	Probable sodium/metabolite cotransporter BASS5, chloroplastic	61.129%	Swiss-Prot	strong database homology
`B8BDK4`	Oryza sativa subsp. indica	Probable sodium/metabolite cotransporter BASS5, chloroplastic	61.129%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card