LXL04_029426 | RubberDandelionOmics

Gene overview

LXL04_029426

Reference: OH-1004 Chr: Chr06 Coordinates: 90173464-90175758 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · LXL04_029426|LXL04_029426|OH1004|cDNA

ATGAAGGTGTCGGGATCGTCGGAAAAGGAGGTGACGAGATCGTCTACAAAGGCGTCATGCCAAACAACTAGCACGCGGAGGTCCGTCCATGACCATGGATTCAATGCCGAGATTCAGACCCTAGGTGAAAAGCCAGATGACCGCGAGGCAACCGGCGAACTGGGTTTTGCTGCACATTGTTGCTTGTTGTGTTCGAGAAATCTAGAGATGGAATCACTGCCGTTGGGTTTTAGATTCCGGCCGACGGACGAGGAACTTAT...

CDS

Download CDS FASTA

1620 bp · LXL04_029426|LXL04_029426|OH1004|CDS

ATGAAGGTGTCGGGATCGTCGGAAAAGGAGGTGACGAGATCGTCTACAAAGGCGTCATGCCAAACAACTAGCACGCGGAGGTCCGTCCATGACCATGGATTCAATGCCGAGATTCAGACCCTAGGTGAAAAGCCAGATGACCGCGAGGCAACCGGCGAACTGGGTTTTGCTGCACATTGTTGCTTGTTGTGTTCGAGAAATCTAGAGATGGAATCACTGCCGTTGGGTTTTAGATTCCGGCCGACGGACGAGGAACTTAT...

Protein

Download Protein FASTA

539 aa · LXL04_029426|LXL04_029426|OH1004|PROTEIN

MKVSGSSEKEVTRSSTKASCQTTSTRRSVHDHGFNAEIQTLGEKPDDREATGELGFAAHCCLLCSRNLEMESLPLGFRFRPTDEELINYYLRQKINGHHSEVHIIPEVDVCKLEPWDLPDQSVIKTDDPEWFFFCPRDRKYPNGHRSNRATSAGYWKATGKDRTIKTRGRSDPKIIGMKKTLVFYRGRAPKGERTHWIMHEYRPTEPDLDGTNPGQTAYVLCRLFRKSDEINATKYDEAEPSSLCLSPTTHKSSPENPPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029426`
TK1151 ID	TkA08G061640
OH-1004 ID	LXL04_029426
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	92.300
Protein coverage (%)	TK1151 40.625 / OH-1004 9.647 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029426

Location Chr06:90173464-90175758 (+)

Description Similar to NTL9: Protein NTM1-like 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35580`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	Identification of a calmodulin-binding NAC protein as a transcriptional repressor in Arabidopsis.2007 · DOI: 10.1074/jbc.m705217200 Regulation of leaf senescence by NTL9-mediated osmotic stress signaling in Arabidopsis.2008 · PMID: 18443413 A NAC transcription factor and SNI1 cooperatively suppress basal pathogen resistance in Arabidopsis thaliana.2012 · DOI: 10.1093/nar/gks683 The Pseudomonas syringae type III effector HopD1 suppresses effector-triggered immunity, localizes to the endoplasmic reticulum, and targets the Arabidopsis transcription factor NTL9.2014 · DOI: 10.1111/nph.12626
`At1g33060`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	No verified direct reference in this release
`At5g24590`	Transcription activator essential for the anti-viral defense called virus basal resistance response pathway.	No verified direct reference in this release
`At3g49530`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP).	Cold activation of a plasma membrane-tethered NAC transcription factor induces a pathogen resistance response in Arabidopsis.2010 · DOI: 10.1111/j.1365-313x.2009.04091.x Proteolytic processing of an Arabidopsis membrane-bound NAC transcription factor is triggered by cold-induced changes in membrane fluidity.2010 · DOI: 10.1042/bj20091762 Controlled nuclear import of the transcription factor NTL6 reveals a cytoplasmic role of SnRK2.8 in the drought-stress response.2012 · DOI: 10.1042/bj20120244
`At5g17260`	Transcription factor directing sieve element enucleation and cytosol degradation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029426 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002230 positive regulation of defense response to virus by host Biological Process

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009615 response to virus Biological Process

GO:0016032 viral process Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0051607 defense response to virus Biological Process

GO:0070417 cellular response to cold Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0071470 cellular response to osmotic stress Biological Process

KEGG gene cross-reference

ath:AT1G33060

ath:AT3G49530

ath:AT4G35580

ath:AT5G17260

ath:AT5G24590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.844

Rank 1 · LXL04_029426 · OH-1004

Cytoplasm0.181

Rank 2 · LXL04_029426 · OH-1004

Cell membrane0.075

Rank 3 · LXL04_029426 · OH-1004

Endoplasmic reticulum0.056

Rank 4 · LXL04_029426 · OH-1004

Plastid0.020

Rank 5 · LXL04_029426 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM74-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029426	`PF02365.21`	NAM	74	203	3.7e-49	167.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JN35`	Arabidopsis thaliana	Protein NTM1-like 9	47.381%	Swiss-Prot	moderate database homology
`B5X570`	Arabidopsis thaliana	NAC domain-containing protein 14	69.634%	Swiss-Prot	weak database homology
`Q9LKG8`	Arabidopsis thaliana	NAC domain-containing protein 91	42.494%	Swiss-Prot	moderate database homology
`Q9SCK6`	Arabidopsis thaliana	NAC domain-containing protein 62	39.709%	Swiss-Prot	moderate database homology
`Q9FFI5`	Arabidopsis thaliana	NAC domain-containing protein 86	64.331%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card