Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2289 bp · LXL04_028384|LXL04_028384|OH1004|cDNA
ATGGGCAAGCGCCGGCGTCGGACCTCTTCCTGCACCACgtcttcttcgtcttcttcatcTTCGTCGACCAACACTTCCTACACCTGTTCCACTGTACAAAATTCGGATCCTCAGCTCCTCTTCGGGATCATGCTTGCCGCTCTTTCGAACCGTGAATTGGGAGCCACATCAGAAGGAAACCTAGTTATCCAAAAAGCCCTACACCATCTTCTTCTCTCCCTCCTCTCCAAATCGCCCAATTCAGTCATGCGCTGCCAACA...
2289 bp · LXL04_028384|LXL04_028384|OH1004|CDS
ATGGGCAAGCGCCGGCGTCGGACCTCTTCCTGCACCACGTCTTCTTCGTCTTCTTCATCTTCGTCGACCAACACTTCCTACACCTGTTCCACTGTACAAAATTCGGATCCTCAGCTCCTCTTCGGGATCATGCTTGCCGCTCTTTCGAACCGTGAATTGGGAGCCACATCAGAAGGAAACCTAGTTATCCAAAAAGCCCTACACCATCTTCTTCTCTCCCTCCTCTCCAAATCGCCCAATTCAGTCATGCGCTGCCAACA...
Protein
Download Protein FASTA762 aa · LXL04_028384|LXL04_028384|OH1004|PROTEIN
MGKRRRRTSSCTTSSSSSSSSSTNTSYTCSTVQNSDPQLLFGIMLAALSNRELGATSEGNLVIQKALHHLLLSLLSKSPNSVMRCQQILHIPLISLLPVLLNSKCSVVACTGLEIVGAASLFSIEMNEQIASDEEIVKGLITAVASSRKSVAMAACNALLDLLTTSAGRCKLLEISAIDNLIFRFLQVPKSSTPSVSLIMEDKACFKIGFMEDEYPILLLDIAISLINDCTLDQLRNIPRELSKNLLKFMEQIWAKVCKN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_028384 |
|---|---|
| TK1151 ID | TkA07G149010 |
| OH-1004 ID | LXL04_028384 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 40.157Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_028384 |
|---|---|
| Location | Chr06:39550441-39554302 (-) |
| Description | Similar to GL12933: Bifunctional lysine-specific demethylase and histidyl-hydroxylase NO66 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0042127 regulation of cell population proliferation Biological Process GO:0042254 ribosome biogenesis Biological Process GO:0045471 response to ethanol Biological Process GO:0045892 negative regulation of DNA-templated transcription Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005667 transcription regulator complex Cellular Component GO:0005730 nucleolus Cellular Component GO:0005829 cytosol Cellular Component GO:0003714 transcription corepressor activity Molecular Function GO:0005506 iron ion binding Molecular Function |
| KEGG gene cross-reference | aag:5571894 dpe:6597402 mmu:67014 rno:266670 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08007.19JmjC_2444-559 aaPF13621.13Cupin_8458-600 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_028384 | PF08007.19 | JmjC_2 | 444 | 559 | 1.3e-18 | 67.5 |
| LXL04_028384 | PF13621.13 | Cupin_8 | 458 | 600 | 1.3e-07 | 32.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.