LXL04_028287 | RubberDandelionOmics

Gene overview

LXL04_028287

Reference: OH-1004 Chr: Chr06 Coordinates: 36846412-36846975 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

564 bp · LXL04_028287|LXL04_028287|OH1004|cDNA

ATGCCAAACACCAATCGCAATCGTTATTCGGACACCCGTAATGATGCCACCGCCATTAACAGTTCAACACCCAAAAGCAAGCCAAAGCTGTTGTCAATCTTTCTTAAATTCATGGTTATGTCCCTAATTATCTCTCTCTTCCTTATCTTCGTCGGCCTGGCTGCCATCCTCCTACTCCACATCCTCATTTTCGGCTCCTTCCTTCACCGCCGCCGCCGCCAACACGCTACCCCACCACCCACCTCCTCCTCTTACTCTCG...

CDS

Download CDS FASTA

564 bp · LXL04_028287|LXL04_028287|OH1004|CDS

ATGCCAAACACCAATCGCAATCGTTATTCGGACACCCGTAATGATGCCACCGCCATTAACAGTTCAACACCCAAAAGCAAGCCAAAGCTGTTGTCAATCTTTCTTAAATTCATGGTTATGTCCCTAATTATCTCTCTCTTCCTTATCTTCGTCGGCCTGGCTGCCATCCTCCTACTCCACATCCTCATTTTCGGCTCCTTCCTTCACCGCCGCCGCCGCCAACACGCTACCCCACCACCCACCTCCTCCTCTTACTCTCG...

Protein

Download Protein FASTA

187 aa · LXL04_028287|LXL04_028287|OH1004|PROTEIN

MPNTNRNRYSDTRNDATAINSSTPKSKPKLLSIFLKFMVMSLIISLFLIFVGLAAILLLHILIFGSFLHRRRRQHATPPPTSSSYSRIDLQNNLPSFRYSTAASGSPDCSICLECFSEGDLCRELPVCNHVFHVHCVDSWLTKVPNCPVCRTTVRLEVDRPSDMIVSDDDYKFLWVVGVGRQGVVNY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028287`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028287

Location Chr06:36846412-36846975 (-)

Description Similar to ATL56: RING-H2 finger protein ATL56

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g18670`	RING-H2 finger protein ATL56.	No verified direct reference in this release
`At3g18930`	RING-H2 finger protein ATL65.	No verified direct reference in this release
`At4g30370`	RING-H2 finger protein ATL14.	No verified direct reference in this release
`At4g28890`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At2g42360`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8, UBC10, UBC11, UBC28, UBC29, UBC30, UBC35 and UBC36 in vitro.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028287 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0031982 vesicle Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT2G18670

ath:AT2G42360

ath:AT3G18930

ath:AT4G28890

ath:AT4G30370

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.322

Rank 1 · LXL04_028287 · OH-1004

Endoplasmic reticulum0.262

Rank 2 · LXL04_028287 · OH-1004

Lysosome / Vacuole0.197

Rank 3 · LXL04_028287 · OH-1004

Nucleus0.195

Rank 4 · LXL04_028287 · OH-1004

Cytoplasm0.173

Rank 5 · LXL04_028287 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2108-151 aa

PF17123.12zf-RING_11108-137 aa

PF12678.14zf-rbx1111-151 aa

PF12861.14zf-ANAPC11111-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028287	`PF13639.13`	zf-RING_2	108	151	1.4e-11	45.1
LXL04_028287	`PF17123.12`	zf-RING_11	108	137	1.4e-07	31.8
LXL04_028287	`PF12678.14`	zf-rbx1	111	151	5.8e-09	36.8
LXL04_028287	`PF12861.14`	zf-ANAPC11	111	156	7.3e-06	26.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZV51`	Arabidopsis thaliana	RING-H2 finger protein ATL56	37.349%	Swiss-Prot	moderate database homology
`Q67YI6`	Arabidopsis thaliana	RING-H2 finger protein ATL65	45.455%	Swiss-Prot	weak database homology
`Q9M0C3`	Arabidopsis thaliana	RING-H2 finger protein ATL14	48.611%	Swiss-Prot	weak database homology
`Q5XF85`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL42	40.698%	Swiss-Prot	weak database homology
`Q9SLC3`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL41	47.692%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card