LXL04_028259 | RubberDandelionOmics

Gene overview

LXL04_028259

Reference: OH-1004 Chr: Chr06 Coordinates: 36112221-36113230 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

657 bp · LXL04_028259|LXL04_028259|OH1004|cDNA

ATGACAGCGCCAAACATGGCGGCGATCACTGCATCCCTGGAAAGATCTCTTCAAAGCTTCTCTCTAAACAACCAAAGCAGCATCGGTGTCAGCGGCCGTGAAGGCTCCGGCTCCGGCATCGACAGGTCATCATCTTCCTCAGAGTCTCAGAATAATCGTTCAACAAACTCTTCCGACGCCACCTTGGAACTCAATTCAAATATAACACTTCCCTACCATTGGGAGCAATGCCTGGATTTAAAGACAGGGGAGGTGTATTA...

CDS

Download CDS FASTA

657 bp · LXL04_028259|LXL04_028259|OH1004|CDS

ATGACAGCGCCAAACATGGCGGCGATCACTGCATCCCTGGAAAGATCTCTTCAAAGCTTCTCTCTAAACAACCAAAGCAGCATCGGTGTCAGCGGCCGTGAAGGCTCCGGCTCCGGCATCGACAGGTCATCATCTTCCTCAGAGTCTCAGAATAATCGTTCAACAAACTCTTCCGACGCCACCTTGGAACTCAATTCAAATATAACACTTCCCTACCATTGGGAGCAATGCCTGGATTTAAAGACAGGGGAGGTGTATTA...

Protein

Download Protein FASTA

218 aa · LXL04_028259|LXL04_028259|OH1004|PROTEIN

MTAPNMAAITASLERSLQSFSLNNQSSIGVSGREGSGSGIDRSSSSSESQNNRSTNSSDATLELNSNITLPYHWEQCLDLKTGEVYYINWRTGMKSQEDPRTVDDGFSSYFYTDDEEDEEEEEEGEEESSFGSGGSSVESSPAASSSRKQKQNQDEEDEDEENEEDDDDENESRIETHVLVVAGCKGCFMYFMVPKQVEDCPKCCGQLIHFDRSDDNA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028259`
TK1151 ID	TkA07G136030
OH-1004 ID	LXL04_028259
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.246 / OH-1004 51.376 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028259

Location Chr06:36112221-36113230 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g33510`	Negatively regulates the cuticle development by interacting with the HD-ZIP IV transcription factor HDG1.	CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis.2011 · DOI: 10.1105/tpc.111.088625 CFLAP1 and CFLAP2 Are Two bHLH Transcription Factors Participating in Synergistic Regulation of AtCFL1-Mediated Cuticle Development in Arabidopsis.2016 · DOI: 10.1371/journal.pgen.1005744
`At1g28070`	May negatively regulate the cuticle development by interacting with the HD-ZIP IV transcription factor HDG1.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8AIM8`	Negatively regulates the cuticle development probably by interacting with the HD-ZIP IV transcription factor HDG1.	No verified direct reference in this release
`Os02g0516400`	Negatively regulates the cuticle development probably by interacting with the HD-ZIP IV transcription factor HDG1.	CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis.2011 · DOI: 10.1105/tpc.111.088625

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028259 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0160062 cutin-based cuticle development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004386 helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G28070

ath:AT2G33510

dosa:Os02g0516400

osa:4329477

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.722

Rank 1 · LXL04_028259 · OH-1004

Cytoplasm0.336

Rank 2 · LXL04_028259 · OH-1004

Cell membrane0.073

Rank 3 · LXL04_028259 · OH-1004

Endoplasmic reticulum0.044

Rank 4 · LXL04_028259 · OH-1004

Lysosome / Vacuole0.029

Rank 5 · LXL04_028259 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5HZ54`	Arabidopsis thaliana	Protein CURLY FLAG LEAF 1	45.581%	Swiss-Prot	moderate database homology
`Q9C7E6`	Arabidopsis thaliana	Protein CURLY FLAG LEAF 2	40.385%	Swiss-Prot	moderate database homology
`B8AIM8`	Oryza sativa subsp. indica	Protein CURLY FLAG LEAF 1	41.584%	Swiss-Prot	weak database homology
`Q0E0W7`	Oryza sativa subsp. japonica	Protein CURLY FLAG LEAF 1	41.584%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card