LXL04_027923 | RubberDandelionOmics

Gene overview

LXL04_027923

Reference: OH-1004 Chr: Chr06 Coordinates: 26666387-26673868 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4641 bp · LXL04_027923|LXL04_027923|OH1004|cDNA

ATGGGAAACAAGATCGCACGAACGACGCAAGCTTCGGCTACCGAGTATTACCTTCACGACTTACCATCTTCGTACAACTTGGTACTAAAAGAGGTGTTGGGAAGAGCACGGTTCCTGAAATCCATTCAGTGTAAGCATGACGAAGGATTGGTTTTAGTCAAGGTTTATTTCAAACGTGGTGACTCGATTGATCTTCGGGACTATGAGCGGCGATTATCTCAGATTCGTGAGATCTTTAGCCGTATGGAGAATTCTCACGT...

CDS

Download CDS FASTA

4641 bp · LXL04_027923|LXL04_027923|OH1004|CDS

ATGGGAAACAAGATCGCACGAACGACGCAAGCTTCGGCTACCGAGTATTACCTTCACGACTTACCATCTTCGTACAACTTGGTACTAAAAGAGGTGTTGGGAAGAGCACGGTTCCTGAAATCCATTCAGTGTAAGCATGACGAAGGATTGGTTTTAGTCAAGGTTTATTTCAAACGTGGTGACTCGATTGATCTTCGGGACTATGAGCGGCGATTATCTCAGATTCGTGAGATCTTTAGCCGTATGGAGAATTCTCACGT...

Protein

Download Protein FASTA

1546 aa · LXL04_027923|LXL04_027923|OH1004|PROTEIN

MGNKIARTTQASATEYYLHDLPSSYNLVLKEVLGRARFLKSIQCKHDEGLVLVKVYFKRGDSIDLRDYERRLSQIREIFSRMENSHVWPFQFWLETDKAAYLLRQYFFNNLHDRLSTRPFLSLVEKKWLAFQLLYAVKQSHDYGVCHGDIKCENVLVTSWNWLYLADFASFKPTYIPHDDPSDFSFFFDTGGRRRCYLAPERFYEHGGEIQVSQDAPLRPSMDIFAVGCVIAELFLEGQPLFELSQLLAYRRGQFDPSQH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027923`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027923

Location Chr06:26666387-26673868 (+)

Description Similar to VPS15: Serine/threonine-protein kinase VPS15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g29380`	Serine/threonine-protein kinase required for cytoplasm to vacuole transport (Cvt) and autophagy as a part of the autophagy-specific VPS34 PI3-kinase complex I (By similarity).	Arabidopsis AtVPS15 is essential for pollen development and germination through modulating phosphatidylinositol 3-phosphate formation.2011 · DOI: 10.1007/s11103-011-9806-9 Arabidopsis AtVPS15 plays essential roles in pollen germination possibly by interacting with AtVPS34.2012 · DOI: 10.1016/j.jgg.2012.01.002

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027923 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000011 vacuole inheritance Biological Process

GO:0000425 pexophagy Biological Process

GO:0006623 protein targeting to vacuole Biological Process

GO:0006914 autophagy Biological Process

GO:0009555 pollen development Biological Process

GO:0009846 pollen germination Biological Process

GO:0016236 macroautophagy Biological Process

GO:0023052 signaling Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0045053 protein retention in Golgi apparatus Biological Process

GO:0045324 late endosome to vacuole transport Biological Process

KEGG gene cross-reference

ath:AT4G29380

sce:YBR097W

spo:2539996

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.494

Rank 1 · LXL04_027923 · OH-1004

Nucleus0.254

Rank 2 · LXL04_027923 · OH-1004

Golgi apparatus0.180

Rank 3 · LXL04_027923 · OH-1004

Lysosome / Vacuole0.130

Rank 4 · LXL04_027923 · OH-1004

Cell membrane0.107

Rank 5 · LXL04_027923 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase30-293 aa

PF22956.3PIK3R4-like_middle452-811 aa

PF02985.29HEAT492-520 aa

PF23381.2Beta-prop_IFT122_1st1062-1111 aa

PF25175.2Beta-prop_WDR51063-1151 aa

PF24814.2WD40_Prp191063-1264 aa

PF20426.5NBCH_WD401063-1252 aa

PF00400.39WD401064-1101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027923	`PF00069.32`	Pkinase	30	293	5.6e-19	69.3
LXL04_027923	`PF22956.3`	PIK3R4-like_middle	452	811	4.9e-123	411.1
LXL04_027923	`PF02985.29`	HEAT	492	520	1.6e-08	34.8
LXL04_027923	`PF23381.2`	Beta-prop_IFT122_1st	1062	1111	6.9e-16	59.1
LXL04_027923	`PF25175.2`	Beta-prop_WDR5	1063	1151	2.5e-16	60.6
LXL04_027923	`PF24814.2`	WD40_Prp19	1063	1264	7e-15	55.5
LXL04_027923	`PF20426.5`	NBCH_WD40	1063	1252	1.7e-07	31.1
LXL04_027923	`PF00400.39`	WD40	1064	1101	2.4e-22	79.1
LXL04_027923	`PF24805.2`	EIF3I	1065	1112	3.8e-07	30.3
LXL04_027923	`PF25173.2`	Beta-prop_WDR3_1st	1066	1102	1.9e-14	54.5
LXL04_027923	`PF24796.2`	WDR55	1066	1152	2.8e-12	47.0
LXL04_027923	`PF24807.2`	WD40_CDC20-Fz	1066	1112	1.6e-10	41.5
LXL04_027923	`PF25168.2`	Beta-prop_WDR36-Utp21_2nd	1066	1101	1.4e-08	35.1
LXL04_027923	`PF25174.2`	Beta-prop_THOC3	1067	1262	8.2e-16	58.5
LXL04_027923	`PF24817.2`	WD40_WDHD1_1st	1074	1274	2.8e-15	57.0
LXL04_027923	`PF23342.2`	WDR90_beta-prop_4th	1076	1152	1.1e-07	32.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M0E5`	Arabidopsis thaliana	Serine/threonine-protein kinase VPS15	64.771%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card