LXL04_027599 | RubberDandelionOmics

Gene overview

LXL04_027599

Reference: OH-1004 Chr: Chr06 Coordinates: 19906827-19912336 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3270 bp · LXL04_027599|LXL04_027599|OH1004|cDNA

ATGAGTACGTATAATTACGTTGTCACGGCTCATAAGCCAACGAATGTCACTCATTCCTGCGTCGGCAATTTCACTGGTCCGCAAGAACTCAATCTTATTATCGCGAAATGTACCCGTATCGAGATTCATTTACTTACTCCACAAGGCCTGCAGCCTATGTTGGATGTGCCAATATACGGAAGAATTGCAACTTTAGAACTTTTCCGACCTCACGGTGAAACACAAGACGTTCTGTTTATTGCAACAGAAAGGTACAAGTT...

CDS

Download CDS FASTA

3270 bp · LXL04_027599|LXL04_027599|OH1004|CDS

ATGAGTACGTATAATTACGTTGTCACGGCTCATAAGCCAACGAATGTCACTCATTCCTGCGTCGGCAATTTCACTGGTCCGCAAGAACTCAATCTTATTATCGCGAAATGTACCCGTATCGAGATTCATTTACTTACTCCACAAGGCCTGCAGCCTATGTTGGATGTGCCAATATACGGAAGAATTGCAACTTTAGAACTTTTCCGACCTCACGGTGAAACACAAGACGTTCTGTTTATTGCAACAGAAAGGTACAAGTT...

Protein

Download Protein FASTA

1089 aa · LXL04_027599|LXL04_027599|OH1004|PROTEIN

MSTYNYVVTAHKPTNVTHSCVGNFTGPQELNLIIAKCTRIEIHLLTPQGLQPMLDVPIYGRIATLELFRPHGETQDVLFIATERYKFCVLQWDAEANEVNTRAMGDVSDRIGRPTDNGQIGIIDPDCRLIGLHLYDGLFKVIPFDNKGQLKEAFNIRLEELQVLDIKFLYGCPKPTIVVLYQDNKDARHVKTYEVSLKDKDFVEGPWSQNNLDNGADLLIPVPPPFCGVLIIGEETIVYCSASAFKAIPIRPSITRAYGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027599`
TK1151 ID	TkA07G077460
OH-1004 ID	LXL04_027599
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027599

Location Chr06:19906827-19912336 (+)

Description Similar to DDB1: DNA damage-binding protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g05420`	Component of light signal transduction machinery.	Regulation and role of Arabidopsis CUL4-DDB1A-DDB2 in maintaining genome integrity upon UV stress.2008 · DOI: 10.1371/journal.pgen.1000093
`At4g21100`	Component of light signal transduction machinery.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0592400`	Required for DNA repair.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027599 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0080008 Cul4-RING E3 ubiquitin ligase complex Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003684 damaged DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G05420

ath:AT4G21100

dosa:Os05g0592400

osa:4339794

sly:778355

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.578

Rank 1 · LXL04_027599 · OH-1004

Cytoplasm0.444

Rank 2 · LXL04_027599 · OH-1004

Lysosome / Vacuole0.075

Rank 3 · LXL04_027599 · OH-1004

Endoplasmic reticulum0.060

Rank 4 · LXL04_027599 · OH-1004

Golgi apparatus0.060

Rank 5 · LXL04_027599 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10433.16Beta-prop_RSE1_1st16-344 aa

PF23726.2Beta-prop_RSE1_2nd389-698 aa

PF03178.22CPSF_A746-1058 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027599	`PF10433.16`	Beta-prop_RSE1_1st	16	344	5.4e-82	276.3
LXL04_027599	`PF23726.2`	Beta-prop_RSE1_2nd	389	698	7.2e-67	226.8
LXL04_027599	`PF03178.22`	CPSF_A	746	1058	8.6e-82	275.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M0V3`	Arabidopsis thaliana	DNA damage-binding protein 1a	88.705%	Swiss-Prot	strong database homology
`O49552`	Arabidopsis thaliana	DNA damage-binding protein 1b	85.308%	Swiss-Prot	strong database homology
`Q6L4S0`	Oryza sativa subsp. japonica	DNA damage-binding protein 1	82.661%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card