LXL04_027582 | RubberDandelionOmics

Gene overview

LXL04_027582

Reference: OH-1004 Chr: Chr06 Coordinates: 19402273-19405542 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2001 bp · LXL04_027582|LXL04_027582|OH1004|cDNA

ATGGAAAACACTTTCTCTGCTTTTGGTTCATCTACATCCTCTACTCCAACATTCGgagcatcatcatcatcatcatcatcatcatcaaccCCTTCATTTGCATTTACATTTGCATCTTCTTCAGCTTCCACACCAGCTTCCTCTGCTCCAACAACCACTTTTGGTTTTGGATCTTCCTCTGTTGCTGCAACCGGCTCTATGTTTGGTGCATCTCCATTTGGTGGATCTGGATTGTTTGGATCAAGCTCTAgtaccaccac...

CDS

Download CDS FASTA

2001 bp · LXL04_027582|LXL04_027582|OH1004|CDS

ATGGAAAACACTTTCTCTGCTTTTGGTTCATCTACATCCTCTACTCCAACATTCGGAGCATCATCATCATCATCATCATCATCATCAACCCCTTCATTTGCATTTACATTTGCATCTTCTTCAGCTTCCACACCAGCTTCCTCTGCTCCAACAACCACTTTTGGTTTTGGATCTTCCTCTGTTGCTGCAACCGGCTCTATGTTTGGTGCATCTCCATTTGGTGGATCTGGATTGTTTGGATCAAGCTCTAGTACCACCAC...

Protein

Download Protein FASTA

666 aa · LXL04_027582|LXL04_027582|OH1004|PROTEIN

MENTFSAFGSSTSSTPTFGASSSSSSSSSTPSFAFTFASSSASTPASSAPTTTFGFGSSSVAATGSMFGASPFGGSGLFGSSSSTTTTTTTTAAATTSIFGSTSAFGSSNIFGASSTAASSSTTTTAVSSPFSSGLFGSASSTPNFSSTSFGASPNLFGSSSSSSAAPSFSSISSLITTPPASSSAPGFSPTTFGTNNLFGASSTPASASSSTTTTSNIFGSSSSTLFGASPSITSSSSPAPSFSSFGVPSSSSSSSSSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027582`
TK1151 ID	TkA07G074340
OH-1004 ID	LXL04_027582
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	78.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027582

Location Chr06:19402273-19405542 (-)

Description Similar to NUP62: Nuclear pore complex protein NUP62

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45000`	Nuclear pore complex protein NUP62.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027582 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000054 ribosomal subunit export from nucleus Biological Process

GO:0006405 RNA export from nucleus Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0007080 mitotic metaphase chromosome alignment Biological Process

GO:0007098 centrosome cycle Biological Process

GO:0007100 mitotic centrosome separation Biological Process

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0008285 negative regulation of cell population proliferation Biological Process

GO:0009966 regulation of signal transduction Biological Process

GO:0010930 negative regulation of auxin mediated signaling pathway Biological Process

KEGG gene cross-reference

ath:AT2G45000

hsa:23636

mmu:18226

rno:65274

spo:2542668

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.859

Rank 1 · LXL04_027582 · OH-1004

Cytoplasm0.253

Rank 2 · LXL04_027582 · OH-1004

Endoplasmic reticulum0.020

Rank 3 · LXL04_027582 · OH-1004

Cell membrane0.020

Rank 4 · LXL04_027582 · OH-1004

Golgi apparatus0.015

Rank 5 · LXL04_027582 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05064.19Nsp1_C465-562 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027582	`PF05064.19`	Nsp1_C	465	562	7.9e-21	74.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7F7`	Arabidopsis thaliana	Nuclear pore complex protein NUP62	63.975%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card