LXL04_027530 | RubberDandelionOmics

Gene overview

LXL04_027530

Reference: OH-1004 Chr: Chr06 Coordinates: 18267476-18271004 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1245 bp · LXL04_027530|LXL04_027530|OH1004|cDNA

ATGGCCGATGAACCTTCAATCACTCGCTGGTCGTTCCAGGATTTTAAGATGTTTTATGATATTAAGTTTGGGAGGAAAAAGGAATCTACACCAAAAGATGCTGCTGCAAATGGTCAACAGCCTAATGGTCAACCTTCAAGTAATGGAAACTCATCAAATGGAACATCAAATGGAAATGGTCACCCAAATAACACAGCTGAATTGTCTATATATGAGCAGTACAGACAGGCAAGAGAGAATTCAACAGCCAATGGGGTTAC...

CDS

Download CDS FASTA

1245 bp · LXL04_027530|LXL04_027530|OH1004|CDS

ATGGCCGATGAACCTTCAATCACTCGCTGGTCGTTCCAGGATTTTAAGATGTTTTATGATATTAAGTTTGGGAGGAAAAAGGAATCTACACCAAAAGATGCTGCTGCAAATGGTCAACAGCCTAATGGTCAACCTTCAAGTAATGGAAACTCATCAAATGGAACATCAAATGGAAATGGTCACCCAAATAACACAGCTGAATTGTCTATATATGAGCAGTACAGACAGGCAAGAGAGAATTCAACAGCCAATGGGGTTAC...

Protein

Download Protein FASTA

414 aa · LXL04_027530|LXL04_027530|OH1004|PROTEIN

MADEPSITRWSFQDFKMFYDIKFGRKKESTPKDAAANGQQPNGQPSSNGNSSNGTSNGNGHPNNTAELSIYEQYRQARENSTANGVTLPDAEKPKKSLLPAFESAEMRTLAESLSRDIIRGSPDVKWESIKGLENAKRLLKEAVVMPIKYPKYFTGLLSPWKGILLFGPPGTGKTMLAKAVATECNTTFFNISASSIVSKWRGDSEKLVKVLFELARHHAPSTIFLDEIDAIISQRGESRSEHESSRRLKTELLIQMDGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027530`
TK1151 ID	TkA07G071270
OH-1004 ID	LXL04_027530
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 74.396 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027530

Location Chr06:18267476-18271004 (-)

Description Similar to katnal2: Katanin p60 ATPase-containing subunit A-like 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80350`	Severs microtubules in vitro in an ATP-dependent manner.	BOTERO1 is required for normal orientation of cortical microtubules and anisotropic cell expansion in Arabidopsis.2001 · DOI: 10.1046/j.1365-313x.2001.00946.x Cell specification in the Arabidopsis root epidermis requires the activity of ECTOPIC ROOT HAIR 3--a katanin-p60 protein.2002 · DOI: 10.1242/dev.129.1.123 The Arabidopsis lue1 mutant defines a katanin p60 ortholog involved in hormonal control of microtubule orientation during cell growth.2003 · DOI: 10.1242/jcs.00274 KTN80 confers precision to microtubule severing by specific targeting of katanin complexes in plant cells.2017 · DOI: 10.15252/embj.201796823

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027530 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000212 meiotic spindle organization Biological Process

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0010091 trichome branching Biological Process

GO:0010154 fruit development Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0051013 microtubule severing Biological Process

GO:0051211 anisotropic cell growth Biological Process

GO:0090436 leaf pavement cell development Biological Process

GO:0000922 spindle pole Cellular Component

KEGG gene cross-reference

ath:AT1G80350

hsa:83473

mmu:71206

xla:734847

xtr:100036615

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.561

Rank 1 · LXL04_027530 · OH-1004

Nucleus0.366

Rank 2 · LXL04_027530 · OH-1004

Mitochondrion0.107

Rank 3 · LXL04_027530 · OH-1004

Cell membrane0.086

Rank 4 · LXL04_027530 · OH-1004

Endoplasmic reticulum0.065

Rank 5 · LXL04_027530 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00004.36AAA164-295 aa

PF05496.19RuvB_N164-233 aa

PF17862.8AAA_lid_3327-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027530	`PF00004.36`	AAA	164	295	1.8e-41	142.4
LXL04_027530	`PF05496.19`	RuvB_N	164	233	5.8e-06	26.9
LXL04_027530	`PF17862.8`	AAA_lid_3	327	365	1.2e-13	51.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SEX2`	Arabidopsis thaliana	Katanin p60 ATPase-containing subunit A1	40.952%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card