LXL04_027422 | RubberDandelionOmics

Gene overview

LXL04_027422

Reference: OH-1004 Chr: Chr06 Coordinates: 15544474-15547311 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · LXL04_027422|LXL04_027422|OH1004|cDNA

ATGCAAGTATATGATGAGACGAATACGATTATGTCAAAGCAACATTTTATTCCCCTCTTCTCCGTATCTCACCCCACTCCCAACAAACTTCCACTACCTCCATTCGCCGGCCGCCGGCGACTTCCCTTTTCCGGTCATCCTACTCTCCATACTAAATCTGCGATCTTCTGGTCCTCGGAGAAGGATTATTGTTTGTTATATAGATATATGACGTCGGGGACAAGGCTGCCGACTTGGAAGGAGAGGGAGAACAACAAGCG...

CDS

Download CDS FASTA

1161 bp · LXL04_027422|LXL04_027422|OH1004|CDS

ATGCAAGTATATGATGAGACGAATACGATTATGTCAAAGCAACATTTTATTCCCCTCTTCTCCGTATCTCACCCCACTCCCAACAAACTTCCACTACCTCCATTCGCCGGCCGCCGGCGACTTCCCTTTTCCGGTCATCCTACTCTCCATACTAAATCTGCGATCTTCTGGTCCTCGGAGAAGGATTATTGTTTGTTATATAGATATATGACGTCGGGGACAAGGCTGCCGACTTGGAAGGAGAGGGAGAACAACAAGCG...

Protein

Download Protein FASTA

386 aa · LXL04_027422|LXL04_027422|OH1004|PROTEIN

MQVYDETNTIMSKQHFIPLFSVSHPTPNKLPLPPFAGRRRLPFSGHPTLHTKSAIFWSSEKDYCLLYRYMTSGTRLPTWKERENNKRRERRRRAIAAKIFAGLRVYGNYKLPKHCDNNEVLKALCNEAGWIVEEDGTTYRKGCKPATRVDANGGSGSTSASPCSSSYQPSPNTSYNLNPNSSSYPSSISSLYTNGNPDPNALIPWLKNLSSNSSSPSSNFPHHLYFPGGSGSISAPVTPPINSPTCRTPRMTDITMPGNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027422`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027422

Location Chr06:15544474-15547311 (+)

Description Similar to BEH4: BES1/BZR1 homolog protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78700`	BES1/BZR1 homolog protein 4.	No verified direct reference in this release
`At4g18890`	BES1/BZR1 homolog protein 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0552300`	May function in brassinosteroid signaling.	No verified direct reference in this release
`Os01g0203000`	May function in brassinosteroid signaling.	No verified direct reference in this release
`Os02g0233200`	May function in brassinosteroid signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027422 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G78700

ath:AT4G18890

dosa:Os01g0203000

dosa:Os02g0233200

dosa:Os06g0552300

osa:9267338

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.911

Rank 1 · LXL04_027422 · OH-1004

Cytoplasm0.230

Rank 2 · LXL04_027422 · OH-1004

Cell membrane0.023

Rank 3 · LXL04_027422 · OH-1004

Mitochondrion0.019

Rank 4 · LXL04_027422 · OH-1004

Endoplasmic reticulum0.015

Rank 5 · LXL04_027422 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05687.19BES1_N73-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027422	`PF05687.19`	BES1_N	73	210	2.8e-57	194.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZV88`	Arabidopsis thaliana	BES1/BZR1 homolog protein 4	64.776%	Swiss-Prot	strong database homology
`O49404`	Arabidopsis thaliana	BES1/BZR1 homolog protein 3	62.500%	Swiss-Prot	strong database homology
`Q5Z9E5`	Oryza sativa subsp. japonica	Protein BZR1 homolog 3	60.234%	Swiss-Prot	strong database homology
`Q0JPT4`	Oryza sativa subsp. japonica	Protein BZR1 homolog 2	56.342%	Swiss-Prot	strong database homology
`Q6EUF1`	Oryza sativa subsp. japonica	Protein BZR1 homolog 4	50.279%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card