LXL04_027078 | RubberDandelionOmics

Gene overview

LXL04_027078

Reference: OH-1004 Chr: Chr06 Coordinates: 8403977-8409333 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3291 bp · LXL04_027078|LXL04_027078|OH1004|cDNA

ATGTCATCATCATTTGCATCCCAATCATCACCTCGGTTACAACcacaagaagaagaagaagaagaagaagaagaagaagaagagatcGTACTTTCAAATGCAAGAGCCCATAAACAAAGAGCCCAGTTCATCTCCGAAGAAGTCCGTCCTCTCCCCTCAAACTCCCCCGGGTTTCAAACCTTCAAGTGTTCAACTGCCGCCGGAAAATTCATCAGTGACCACTCAGCGATGGAGTTCGAAAAGAGAAAGAAAGCCACCTT...

CDS

Download CDS FASTA

3291 bp · LXL04_027078|LXL04_027078|OH1004|CDS

ATGTCATCATCATTTGCATCCCAATCATCACCTCGGTTACAACCACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGATCGTACTTTCAAATGCAAGAGCCCATAAACAAAGAGCCCAGTTCATCTCCGAAGAAGTCCGTCCTCTCCCCTCAAACTCCCCCGGGTTTCAAACCTTCAAGTGTTCAACTGCCGCCGGAAAATTCATCAGTGACCACTCAGCGATGGAGTTCGAAAAGAGAAAGAAAGCCACCTT...

Protein

Download Protein FASTA

1096 aa · LXL04_027078|LXL04_027078|OH1004|PROTEIN

MSSSFASQSSPRLQPQEEEEEEEEEEEEIVLSNARAHKQRAQFISEEVRPLPSNSPGFQTFKCSTAAGKFISDHSAMEFEKRKKATLTTMSSPEPDKSPKGDIDIPIVPLLKTLNSHPSYFTTSSCSGRISILSTPTAATTTTVKKKAKGGNWVFITHEPADANSVQNLIFPPNPTADSIQSDNQGNLVFRFEPLIIAVECKDVLSAQKLVSLAISCGFRESGITNVNNKRVIVAIRCSIRLEVPLGDTNNIMVSKEYLN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027078`
TK1151 ID	TkA07G030530
OH-1004 ID	LXL04_027078
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 96.442 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027078

Location Chr06:8403977-8409333 (-)

Description Similar to At4g04670: tRNA wybutosine-synthesizing protein 2/3/4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04670`	S-adenosyl-L-methionine-dependent transferase that acts as a component of the wybutosine biosynthesis pathway.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0515000`	S-adenosyl-L-methionine-dependent transferase that acts as a component of the wybutosine biosynthesis pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027078 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0030488 tRNA methylation Biological Process

GO:0031591 wybutosine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0008175 tRNA methyltransferase activity Molecular Function

GO:0102522 tRNA 4-demethylwyosine alpha-amino-alpha-carboxypropyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT4G04670

bta:516516

dosa:Os07g0515000

dre:564925

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.528

Rank 1 · LXL04_027078 · OH-1004

Nucleus0.389

Rank 2 · LXL04_027078 · OH-1004

Peroxisome0.084

Rank 3 · LXL04_027078 · OH-1004

Mitochondrion0.081

Rank 4 · LXL04_027078 · OH-1004

Plastid0.069

Rank 5 · LXL04_027078 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02676.20TYW381-284 aa

PF24681.2Kelch_KLHDC2_KLHL20_DRC7366-489 aa

PF13415.13Beta-prop_FBX42366-544 aa

PF24981.2Beta-prop_ATRN-LZTR1383-481 aa

PF25210.2Kelch_FKB95404-515 aa

PF13418.13Beta-prop_TYW4418-652 aa

PF01344.32Kelch_1420-462 aa

PF24996.1NANM425-541 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027078	`PF02676.20`	TYW3	81	284	7e-67	225.6
LXL04_027078	`PF24681.2`	Kelch_KLHDC2_KLHL20_DRC7	366	489	1.4e-57	195.3
LXL04_027078	`PF13415.13`	Beta-prop_FBX42	366	544	2.5e-43	148.8
LXL04_027078	`PF24981.2`	Beta-prop_ATRN-LZTR1	383	481	9.1e-35	121.0
LXL04_027078	`PF25210.2`	Kelch_FKB95	404	515	5.3e-17	63.0
LXL04_027078	`PF13418.13`	Beta-prop_TYW4	418	652	6.9e-24	85.8
LXL04_027078	`PF01344.32`	Kelch_1	420	462	3.2e-27	94.4
LXL04_027078	`PF24996.1`	NANM	425	541	1e-09	38.5
LXL04_027078	`PF25852.1`	DUF6242_C	431	542	1.8e-06	28.5
LXL04_027078	`PF13964.13`	Beta-prop_Calicin	434	560	4.7e-08	33.1
LXL04_027078	`PF24981.2`	Beta-prop_ATRN-LZTR1	447	515	9.1e-35	121.0
LXL04_027078	`PF01344.32`	Kelch_1	473	512	3.2e-27	94.4
LXL04_027078	`PF07646.22`	Kelch_2	473	514	5.3e-21	74.1
LXL04_027078	`PF24681.2`	Kelch_KLHDC2_KLHL20_DRC7	475	645	1.4e-57	195.3
LXL04_027078	`PF24981.2`	Beta-prop_ATRN-LZTR1	484	642	9.1e-35	121.0
LXL04_027078	`PF24996.1`	NANM	495	591	1e-09	38.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4K1`	Arabidopsis thaliana	tRNA wybutosine-synthesizing protein 2/3/4	55.707%	Swiss-Prot	strong database homology
`Q8H4D4`	Oryza sativa subsp. japonica	tRNA wybutosine-synthesizing protein 2/3/4	49.717%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card