LXL04_026947 | RubberDandelionOmics

Gene overview

LXL04_026947

Reference: OH-1004 Chr: Chr06 Coordinates: 5736442-5739492 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1410 bp · LXL04_026947|LXL04_026947|OH1004|cDNA

ATGGGTTCCAGCAGTAGTCGATTGGGGTCGGATCGCTCTTCAAATCCCTCACGATTGAATCGAACAAAACGGAAGCTCTCTTCAATTCTACTGTGCGGTCACAGTCACACCTCCAATTCCAATTCTCCTACGTCTGCGTTAGTGTTGGAATCACCAACAAGCTCTATAGAAAACCTTCCTCCTGCTAGCATCGAATCCATAACATCTGCAGGTGTGTCTACTTCCTTCTTTGATTCCGACCGTGTTTGCACAAGTTCCAA...

CDS

Download CDS FASTA

1410 bp · LXL04_026947|LXL04_026947|OH1004|CDS

ATGGGTTCCAGCAGTAGTCGATTGGGGTCGGATCGCTCTTCAAATCCCTCACGATTGAATCGAACAAAACGGAAGCTCTCTTCAATTCTACTGTGCGGTCACAGTCACACCTCCAATTCCAATTCTCCTACGTCTGCGTTAGTGTTGGAATCACCAACAAGCTCTATAGAAAACCTTCCTCCTGCTAGCATCGAATCCATAACATCTGCAGGTGTGTCTACTTCCTTCTTTGATTCCGACCGTGTTTGCACAAGTTCCAA...

Protein

Download Protein FASTA

469 aa · LXL04_026947|LXL04_026947|OH1004|PROTEIN

MGSSSSRLGSDRSSNPSRLNRTKRKLSSILLCGHSHTSNSNSPTSALVLESPTSSIENLPPASIESITSAGVSTSFFDSDRVCTSSKTSESEPESCNSSSKNAALNPINSSQDDKASTSYNGQPSQEPITGNHRPESESELELELESVSPINERAPVNFTPITSIEENIDSDSGRNQNETVRNPDSDTRALLVLSDSFLSLRIFGSGIGIASSGSGVSSSDSDPDVISGRILVVNTGNGGSERRNGGRLFGDTSARRGSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026947`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026947

Location Chr06:5736442-5739492 (-)

Description Similar to RLIM: E3 ubiquitin-protein ligase RLIM

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0104300`	Involved in the trafficking of vacuolar proteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026947 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000209 protein polyubiquitination Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0015031 protein transport Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031669 cellular response to nutrient levels Biological Process

GO:0032418 lysosome localization Biological Process

GO:0034198 cellular response to amino acid starvation Biological Process

GO:0035519 protein K29-linked ubiquitination Biological Process

GO:0045786 negative regulation of cell cycle Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

dosa:Os08g0104300

hsa:26001

hsa:51132

mmu:19820

mmu:70510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.464

Rank 1 · LXL04_026947 · OH-1004

Nucleus0.365

Rank 2 · LXL04_026947 · OH-1004

Cell membrane0.188

Rank 3 · LXL04_026947 · OH-1004

Endoplasmic reticulum0.076

Rank 4 · LXL04_026947 · OH-1004

Lysosome / Vacuole0.074

Rank 5 · LXL04_026947 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2404-448 aa

PF17123.12zf-RING_11405-433 aa

PF12678.14zf-rbx1405-448 aa

PF13923.13zf-C3HC4_2405-447 aa

PF00097.32zf-C3HC4406-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026947	`PF13639.13`	zf-RING_2	404	448	4.6e-13	49.9
LXL04_026947	`PF17123.12`	zf-RING_11	405	433	2.1e-09	37.6
LXL04_026947	`PF12678.14`	zf-rbx1	405	448	1.3e-07	32.4
LXL04_026947	`PF13923.13`	zf-C3HC4_2	405	447	3.5e-07	30.6
LXL04_026947	`PF00097.32`	zf-C3HC4	406	447	6.8e-08	33.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q69U49`	Oryza sativa subsp. japonica	Receptor homology region, transmembrane domain- and RING domain-containing protein 2	46.970%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card