LXL04_026207 | RubberDandelionOmics

Gene overview

LXL04_026207

Reference: OH-1004 Chr: Chr05 Coordinates: 122747427-122748857 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

642 bp · LXL04_026207|LXL04_026207|OH1004|cDNA

ATGGGCTGTTTCTATTCTACTGAGGGTTTACGGGTTCCTTCCCGTGAAGACCCAAGGAAGCTTGCTTCTCAAACTTCTTTTAGTGTGAGTGAGGTTGAAGCATTATTTGAGCTATTCAAGAGCATAAGCAGTTCTGTAGTTGATGATGGACTAATTAGCAAGGAAGAATTCCTACTAGCAATGTTCAAGAACAAAAGGAAAAAGAATCTGTTTGCAAACAGGATTTTTAGTCTTTTTGACGTTAAGCATAAGGGAGTCAT...

CDS

Download CDS FASTA

642 bp · LXL04_026207|LXL04_026207|OH1004|CDS

ATGGGCTGTTTCTATTCTACTGAGGGTTTACGGGTTCCTTCCCGTGAAGACCCAAGGAAGCTTGCTTCTCAAACTTCTTTTAGTGTGAGTGAGGTTGAAGCATTATTTGAGCTATTCAAGAGCATAAGCAGTTCTGTAGTTGATGATGGACTAATTAGCAAGGAAGAATTCCTACTAGCAATGTTCAAGAACAAAAGGAAAAAGAATCTGTTTGCAAACAGGATTTTTAGTCTTTTTGACGTTAAGCATAAGGGAGTCAT...

Protein

Download Protein FASTA

213 aa · LXL04_026207|LXL04_026207|OH1004|PROTEIN

MGCFYSTEGLRVPSREDPRKLASQTSFSVSEVEALFELFKSISSSVVDDGLISKEEFLLAMFKNKRKKNLFANRIFSLFDVKHKGVIDFGDFVRSLDVFHPKAPFEDKINFSFKLYDLDGTGFIERHEVKLMLVALLRESELRLADETLEMILDNTFLDADANRDGKIDKSEWRAYVTKNPSLLKIMTLPYLRDITTTFPSFVFNSQVEEEIT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026207`
TK1151 ID	TkA06G021480
OH-1004 ID	LXL04_026207
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026207

Location Chr05:122747427-122748857 (-)

Description Similar to CBL9: Calcineurin B-like protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g47100`	Acts as a calcium sensor involved in abscisic acid (ABA) signaling and stress-induced ABA biosynthesis pathways.	The calcium sensor calcineurin B-like 9 modulates abscisic acid sensitivity and biosynthesis in Arabidopsis.2004 · DOI: 10.1105/tpc.021311 A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis.2006 · DOI: 10.1016/j.cell.2006.06.011 Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03236.x The Calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the Arabidopsis NADPH oxidase RBOHF.2013 · DOI: 10.1093/mp/sst009
`At4g17615`	Acts as a calcium sensor involved in the signaling pathway during growth and development and in response to abiotic stresses.	A calcium sensor and its interacting protein kinase are global regulators of abscisic acid signaling in Arabidopsis.2002 · DOI: 10.1016/s1534-5807(02)00229-0 CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis.2003 · DOI: 10.1105/tpc.012393 The calcium sensor CBL1 integrates plant responses to abiotic stresses.2003 · DOI: 10.1046/j.1365-313x.2003.01892.x A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis.2006 · DOI: 10.1016/j.cell.2006.06.011 Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03236.x The Calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the Arabidopsis NADPH oxidase RBOHF.2013 · DOI: 10.1093/mp/sst009 A novel role for Arabidopsis CBL1 in affecting plant responses to glucose and gibberellin during germination and seedling development.2013 · DOI: 10.1371/journal.pone.0056412

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0564800`	Acts as a calcium sensor.	No verified direct reference in this release
`Os02g0291400`	Acts as a calcium sensor.	Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses.2008 · DOI: 10.1016/j.gene.2008.02.011
`Os02g0291000`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026207 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT4G17615

ath:AT5G47100

dosa:Os02g0291000

osa:107276173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.461

Rank 1 · LXL04_026207 · OH-1004

Cell membrane0.346

Rank 2 · LXL04_026207 · OH-1004

Nucleus0.185

Rank 3 · LXL04_026207 · OH-1004

Lysosome / Vacuole0.112

Rank 4 · LXL04_026207 · OH-1004

Golgi apparatus0.096

Rank 5 · LXL04_026207 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499.13EF-hand_7106-172 aa

PF00036.39EF-hand_1109-134 aa

PF13405.13EF-hand_6112-134 aa

PF00036.39EF-hand_1153-179 aa

PF13202.13EF-hand_5156-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026207	`PF13499.13`	EF-hand_7	106	172	2.7e-13	50.8
LXL04_026207	`PF00036.39`	EF-hand_1	109	134	2.2e-18	65.0
LXL04_026207	`PF13405.13`	EF-hand_6	112	134	1.4e-14	53.0
LXL04_026207	`PF00036.39`	EF-hand_1	153	179	2.2e-18	65.0
LXL04_026207	`PF13202.13`	EF-hand_5	156	175	7.2e-14	51.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LTB8`	Arabidopsis thaliana	Calcineurin B-like protein 9	75.714%	Swiss-Prot	strong database homology
`O81445`	Arabidopsis thaliana	Calcineurin B-like protein 1	73.810%	Swiss-Prot	strong database homology
`Q7XC27`	Oryza sativa subsp. japonica	Calcineurin B-like protein 1	73.239%	Swiss-Prot	strong database homology
`Q3HRN9`	Oryza sativa subsp. japonica	Calcineurin B-like protein 8	63.033%	Swiss-Prot	strong database homology
`Q3HRP0`	Oryza sativa subsp. japonica	Calcineurin B-like protein 7	61.611%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card