LXL04_024820 | RubberDandelionOmics

Gene overview

LXL04_024820

Reference: OH-1004 Chr: Chr05 Coordinates: 99566465-99568335 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1050 bp · LXL04_024820|LXL04_024820|OH1004|cDNA

ATGGCTGAGGATCGCAGTGAAGGTTCCGACTCAAACACCAATAAAAACGACCAATTTGCATCCCAAGATGACTACGCTCCCAAGGTCAGAAAACCATACACAATCACAAAACAAAGAGAAAGGTGGACGGAAGAAGAACACAAGAAGTTTCTAGAAGCCCTAAAGCTATACGGGCGCGCATGGCGGCGAATTGAAGAACACGTGGGATCCAAAACCGCAGTCCAAATTAGAAGCCACGCCCAAAAGTTTTTCTCTAAGGT...

CDS

Download CDS FASTA

1050 bp · LXL04_024820|LXL04_024820|OH1004|CDS

ATGGCTGAGGATCGCAGTGAAGGTTCCGACTCAAACACCAATAAAAACGACCAATTTGCATCCCAAGATGACTACGCTCCCAAGGTCAGAAAACCATACACAATCACAAAACAAAGAGAAAGGTGGACGGAAGAAGAACACAAGAAGTTTCTAGAAGCCCTAAAGCTATACGGGCGCGCATGGCGGCGAATTGAAGAACACGTGGGATCCAAAACCGCAGTCCAAATTAGAAGCCACGCCCAAAAGTTTTTCTCTAAGGT...

Protein

Download Protein FASTA

349 aa · LXL04_024820|LXL04_024820|OH1004|PROTEIN

MAEDRSEGSDSNTNKNDQFASQDDYAPKVRKPYTITKQRERWTEEEHKKFLEALKLYGRAWRRIEEHVGSKTAVQIRSHAQKFFSKVVRESTSGDVAEVKPIEIPPPRPKRKPMHPYPRKHSTPIKTGGQHARSTSPNSSGSDQENQSPTSVLSAGGSNAFGLGDSGSPNTEENTSSPPMKMESCCEEKDGGSTQCLKLFGKTVVITDGNNNSNNNNNNNNSSMPVNSLPCGAPVYYMQFLDENMESTVVRSSPSVWGVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024820`
TK1151 ID	TkA06G105380
OH-1004 ID	LXL04_024820
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.588 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024820

Location Chr05:99566465-99568335 (+)

Description Similar to RVE1: Protein REVEILLE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17300`	Morning-phased transcription factor integrating the circadian clock and auxin pathways.	REVEILLE1, a Myb-like transcription factor, integrates the circadian clock and auxin pathways.2009 · DOI: 10.1073/pnas.0813035106 Mapping quantitative trait loci for freezing tolerance in a recombinant inbred line population of Arabidopsis thaliana accessions Tenela and C24 reveals REVEILLE1 as negative regulator of cold acclimation.2013 · DOI: 10.1111/pce.12054
`At5g37260`	Positive regulator for cold-responsive gene expression and cold tolerance.	Constitutive expression of CIR1 (RVE2) affects several circadian-regulated processes and seed germination in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03156.x A DEAD box RNA helicase is critical for pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis.2013 · DOI: 10.1105/tpc.112.108340
`At3g10113`	Probable transcription factor.	No verified direct reference in this release
`At1g18330`	Transcription factor involved in phytochrome A-mediated cotyledon opening.	The novel MYB protein EARLY-PHYTOCHROME-RESPONSIVE1 is a component of a slave circadian oscillator in Arabidopsis.2003 · DOI: 10.1105/tpc.014217

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024820 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009845 seed germination Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010597 green leaf volatile biosynthetic process Biological Process

GO:0010600 regulation of auxin biosynthetic process Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G18330

ath:AT3G10113

ath:AT5G17300

ath:AT5G37260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.978

Rank 1 · LXL04_024820 · OH-1004

Cytoplasm0.088

Rank 2 · LXL04_024820 · OH-1004

Cell membrane0.025

Rank 3 · LXL04_024820 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_024820 · OH-1004

Plastid0.009

Rank 5 · LXL04_024820 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249.38Myb_DNA-binding39-82 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024820	`PF00249.38`	Myb_DNA-binding	39	82	2.4e-14	53.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KGY6`	Arabidopsis thaliana	Protein REVEILLE 1	43.396%	Swiss-Prot	moderate database homology
`F4K5X6`	Arabidopsis thaliana	Protein REVEILLE 2	49.794%	Swiss-Prot	moderate database homology
`F4J2J6`	Arabidopsis thaliana	Protein REVEILLE 7-like	38.123%	Swiss-Prot	moderate database homology
`B3H5A8`	Arabidopsis thaliana	Protein REVEILLE 7	36.203%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card