Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2265 bp · LXL04_023846|LXL04_023846|OH1004|cDNA
ATGATGGTGTTCGGTCACTCAAGCACCGGAGGAGGTTTCCTCCCCGCAAAACTACAGGTTTACCCAGTGGACTACGAGGCCGACGTCTCTCAACGCCTCCTTGAAGCTTCGTCCTGTGGCGATCTCAAATCGGCGTTAGACTGCATTGACGATCCCTACGTTGACGTCAACTATCTCGGCGCTGTTTCCTTGAAGGTTCGTATGGCGGAAGTTAACTGCCGCGATGAATCGGAGAATGTGGTGCGATTTGAGTACCAGGA...
2265 bp · LXL04_023846|LXL04_023846|OH1004|CDS
ATGATGGTGTTCGGTCACTCAAGCACCGGAGGAGGTTTCCTCCCCGCAAAACTACAGGTTTACCCAGTGGACTACGAGGCCGACGTCTCTCAACGCCTCCTTGAAGCTTCGTCCTGTGGCGATCTCAAATCGGCGTTAGACTGCATTGACGATCCCTACGTTGACGTCAACTATCTCGGCGCTGTTTCCTTGAAGGTTCGTATGGCGGAAGTTAACTGCCGCGATGAATCGGAGAATGTGGTGCGATTTGAGTACCAGGA...
Protein
Download Protein FASTA754 aa · LXL04_023846|LXL04_023846|OH1004|PROTEIN
MMVFGHSSTGGGFLPAKLQVYPVDYEADVSQRLLEASSCGDLKSALDCIDDPYVDVNYLGAVSLKVRMAEVNCRDESENVVRFEYQDVKTDVTALFIAVHTGNATLVRKLLSRGADVNQKLFRGFSMTAAVREGHVEIFEILLKAGASQPSCEEALLDASCHGRGGQFVHLLMASDFIRPHIAVHALVTACCRGFIDVVDALLKCGVDVNASARVLLCSSKPSLHTNINCTPLVAAVVSRQVAVVPLLLQAGANINGMVQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_023846 |
|---|---|
| TK1151 ID | TkA06G208200 |
| OH-1004 ID | LXL04_023846 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 76.200 |
| Protein coverage (%) | TK1151 97.634 / OH-1004 78.647Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_023846 |
|---|---|
| Location | Chr05:70826417-70830496 (+) |
| Description | Similar to Ank3: Ankyrin-3 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000281 mitotic cytokinesis Biological Process GO:0006887 exocytosis Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007009 plasma membrane organization Biological Process GO:0007010 cytoskeleton organization Biological Process GO:0007165 signal transduction Biological Process GO:0007528 neuromuscular junction development Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0010650 positive regulation of cell communication by electrical coupling Biological Process GO:0010765 positive regulation of sodium ion transport Biological Process GO:0010960 magnesium ion homeostasis Biological Process GO:0030951 establishment or maintenance of microtubule cytoskeleton polarity Biological Process |
| KEGG gene cross-reference | hsa:286 mmu:11735 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12796.14Ank_290-148 aaPF00023.37Ank93-120 aaPF12796.14Ank_2183-256 aaPF12796.14Ank_2298-343 aaPF12796.14Ank_2352-415 aaPF12796.14Ank_2458-520 aaPF12796.14Ank_2461-541 aaPF13857.13Ank_5483-529 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_023846 | PF12796.14 | Ank_2 | 90 | 148 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF00023.37 | Ank | 93 | 120 | 4.1e-53 | 175.1 |
| LXL04_023846 | PF12796.14 | Ank_2 | 183 | 256 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF12796.14 | Ank_2 | 298 | 343 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF12796.14 | Ank_2 | 352 | 415 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF12796.14 | Ank_2 | 458 | 520 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF12796.14 | Ank_2 | 461 | 541 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF13857.13 | Ank_5 | 483 | 529 | 7.9e-28 | 96.9 |
| LXL04_023846 | PF12796.14 | Ank_2 | 496 | 588 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF13637.13 | Ank_4 | 549 | 578 | 1.7e-28 | 98.7 |
| LXL04_023846 | PF13857.13 | Ank_5 | 554 | 595 | 7.9e-28 | 96.9 |
| LXL04_023846 | PF00023.37 | Ank | 558 | 588 | 4.1e-53 | 175.1 |
| LXL04_023846 | PF13606.13 | Ank_3 | 558 | 586 | 1.1e-37 | 124.0 |
| LXL04_023846 | PF12796.14 | Ank_2 | 562 | 639 | 2.3e-60 | 201.9 |
| LXL04_023846 | PF13637.13 | Ank_4 | 562 | 611 | 1.7e-28 | 98.7 |
| LXL04_023846 | PF00023.37 | Ank | 590 | 615 | 4.1e-53 | 175.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.