LXL04_022732 | RubberDandelionOmics

Gene overview

LXL04_022732

Reference: OH-1004 Chr: Chr05 Coordinates: 7116871-7117794 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

657 bp · LXL04_022732|LXL04_022732|OH1004|cDNA

ATGAATCAAGAACTTGCACGTTGGACTGTTTCGATGGTCAAAACTACATTTGTTGGGCGAACATGTCAAGTTCATGTTTGCTGTGCTGAAACCCACTCATGGCATTTTTTGACGTGTGGTGCAATAAGAGATCTATTTTCAAAGGCATGTCAAAAAACACCGTCAATTGTGTTCATAGATCATATCGAAGTAATTGCTGGAAATTTTAATCTGGAAATCGAAAAGCCATTGCTGAATGAACTAATGAGATGTATGGATAA...

CDS

Download CDS FASTA

657 bp · LXL04_022732|LXL04_022732|OH1004|CDS

ATGAATCAAGAACTTGCACGTTGGACTGTTTCGATGGTCAAAACTACATTTGTTGGGCGAACATGTCAAGTTCATGTTTGCTGTGCTGAAACCCACTCATGGCATTTTTTGACGTGTGGTGCAATAAGAGATCTATTTTCAAAGGCATGTCAAAAAACACCGTCAATTGTGTTCATAGATCATATCGAAGTAATTGCTGGAAATTTTAATCTGGAAATCGAAAAGCCATTGCTGAATGAACTAATGAGATGTATGGATAA...

Protein

Download Protein FASTA

218 aa · LXL04_022732|LXL04_022732|OH1004|PROTEIN

MNQELARWTVSMVKTTFVGRTCQVHVCCAETHSWHFLTCGAIRDLFSKACQKTPSIVFIDHIEVIAGNFNLEIEKPLLNELMRCMDNPRNNKVLVIAATDIPQILDPAIKRRGRFEREIYIGLPDETARLKMLEIVIRGLINQAAGFVTDRMFDDRKLNYVDWRTKPFSEEEMKSYRITTLDLEMAVKQMQSSFPYLRFFNVFFCKGFLLAYIQLFHN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022732`
TK1151 ID	TkA06G457000
OH-1004 ID	LXL04_022732
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	80.000
Protein coverage (%)	TK1151 100.000 / OH-1004 61.468 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022732

Location Chr05:7116871-7117794 (-)

Description Similar to CDC48C: Cell division control protein 48 homolog C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01610`	Probably functions in cell division and growth processes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022732 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006274 DNA replication termination Biological Process

GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process

GO:0010564 regulation of cell cycle process Biological Process

GO:0010636 positive regulation of mitochondrial fusion Biological Process

GO:0015031 protein transport Biological Process

GO:0016236 macroautophagy Biological Process

GO:0016320 endoplasmic reticulum membrane fusion Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0031134 sister chromatid biorientation Biological Process

GO:0032984 protein-containing complex disassembly Biological Process

GO:0034517 ribophagy Biological Process

GO:0034727 piecemeal microautophagy of the nucleus Biological Process

KEGG gene cross-reference

ath:AT3G01610

pfa:PF3D7_0711000

sce:YDL126C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.436

Rank 1 · LXL04_022732 · OH-1004

Nucleus0.328

Rank 2 · LXL04_022732 · OH-1004

Mitochondrion0.173

Rank 3 · LXL04_022732 · OH-1004

Cell membrane0.069

Rank 4 · LXL04_022732 · OH-1004

Peroxisome0.067

Rank 5 · LXL04_022732 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00004.36AAA37-123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022732	`PF00004.36`	AAA	37	123	8.9e-17	62.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SS94`	Arabidopsis thaliana	Cell division control protein 48 homolog C	35.000%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card