LXL04_022582 | RubberDandelionOmics

Gene overview

LXL04_022582

Reference: OH-1004 Chr: Chr05 Coordinates: 1952350-1955697 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1905 bp · LXL04_022582|LXL04_022582|OH1004|cDNA

ATGAACTTTTCGGAAAATTCAGGGGTGAAAATGAACTTGTTCAAAAGTTCGGGGGTCAAACCGAAGTTTTTAGAAGTTCAGGGGCCAAACTGCTATTTTCTGGAAGTTGCTGCTGATGATGACGTCAGCGATGACGTCACTGCTGATGTCagccttcttctccggcgaactggtaTTTTTCCGGCCAACTTTCCGGCAGCTTTGACCGGCGTATTTGGAGaccttccggtggtcaaaaaattccaaaaaATCATCCTTTA...

CDS

Download CDS FASTA

1905 bp · LXL04_022582|LXL04_022582|OH1004|CDS

ATGAACTTTTCGGAAAATTCAGGGGTGAAAATGAACTTGTTCAAAAGTTCGGGGGTCAAACCGAAGTTTTTAGAAGTTCAGGGGCCAAACTGCTATTTTCTGGAAGTTGCTGCTGATGATGACGTCAGCGATGACGTCACTGCTGATGTCAGCCTTCTTCTCCGGCGAACTGGTATTTTTCCGGCCAACTTTCCGGCAGCTTTGACCGGCGTATTTGGAGACCTTCCGGTGGTCAAAAAATTCCAAAAAATCATCCTTTA...

Protein

Download Protein FASTA

634 aa · LXL04_022582|LXL04_022582|OH1004|PROTEIN

MNFSENSGVKMNLFKSSGVKPKFLEVQGPNCYFLEVAADDDVSDDVTADVSLLLRRTGIFPANFPAALTGVFGDLPVVKKFQKIILYYIHSYFLSLGLEELSRRLLALILLHGPPGCGKTTLVHALANEAGFPLHAISATELVSGISGDAFMFYSNFILPYVHQKRTYESYFSKAYRKTPSIVFIDENDVIGSKRDNVQKPMETRMVTHLMKCMELTPRLKKPDALDPGIRRTGRFDHEIHLGVPDENARFQILKVVTRD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022582`
TK1151 ID	TkA06G474600
OH-1004 ID	LXL04_022582
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.600
Protein coverage (%)	TK1151 94.980 / OH-1004 74.606 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022582

Location Chr05:1952350-1955697 (-)

Description Similar to CDC48C: Cell division control protein 48 homolog C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01610`	Probably functions in cell division and growth processes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022582 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000055 ribosomal large subunit export from nucleus Biological Process

GO:0015031 protein transport Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:0051301 cell division Biological Process

GO:0180023 cytosolic large ribosomal subunit assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0030687 preribosome, large subunit precursor Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT3G01610

sce:YLL034C

spo:2539968

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.476

Rank 1 · LXL04_022582 · OH-1004

Nucleus0.206

Rank 2 · LXL04_022582 · OH-1004

Peroxisome0.186

Rank 3 · LXL04_022582 · OH-1004

Mitochondrion0.146

Rank 4 · LXL04_022582 · OH-1004

Endoplasmic reticulum0.068

Rank 5 · LXL04_022582 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03215.22Rad1797-135 aa

PF13191.13AAA_16103-131 aa

PF05496.19RuvB_N107-140 aa

PF13671.13AAA_33108-134 aa

PF00004.36AAA109-243 aa

PF13521.13AAA_28109-143 aa

PF17862.8AAA_lid_3266-302 aa

PF05496.19RuvB_N396-464 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022582	`PF03215.22`	Rad17	97	135	3.3e-09	37.7
LXL04_022582	`PF13191.13`	AAA_16	103	131	1.1e-10	43.0
LXL04_022582	`PF05496.19`	RuvB_N	107	140	5.1e-12	46.6
LXL04_022582	`PF13671.13`	AAA_33	108	134	7.6e-09	36.7
LXL04_022582	`PF00004.36`	AAA	109	243	3.6e-66	222.3
LXL04_022582	`PF13521.13`	AAA_28	109	143	9.2e-09	36.4
LXL04_022582	`PF17862.8`	AAA_lid_3	266	302	1.4e-19	70.0
LXL04_022582	`PF05496.19`	RuvB_N	396	464	5.1e-12	46.6
LXL04_022582	`PF00004.36`	AAA	397	526	3.6e-66	222.3
LXL04_022582	`PF17862.8`	AAA_lid_3	548	589	1.4e-19	70.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SS94`	Arabidopsis thaliana	Cell division control protein 48 homolog C	55.091%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card