LXL04_021466 | RubberDandelionOmics

Gene overview

LXL04_021466

Reference: OH-1004 Chr: Chr04 Coordinates: 130699670-130706118 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4092 bp · LXL04_021466|LXL04_021466|OH1004|cDNA

ATGACTTCTCTGCAGCTGTTACAGTTGACGGAACGAGGCCGTAGCCTGCTTTCGTCAGGTCGCAGGAAAACTCTATTGCTGGCAACTGGCATCATAGTTGCAGGTGGGACTGCTGCATACATGCATTCACAGAGCAGGGTTAGAAGGCCAAGTGGCACTAGTCAACACAATGGATTAGGAGACGATAATGAAAGAGTGGGATTGGATAAGAGTGTTATTAAAAAAAGCAGACAAAAGAAAGGACTGAAATCACTCCAAGT...

CDS

Download CDS FASTA

4092 bp · LXL04_021466|LXL04_021466|OH1004|CDS

ATGACTTCTCTGCAGCTGTTACAGTTGACGGAACGAGGCCGTAGCCTGCTTTCGTCAGGTCGCAGGAAAACTCTATTGCTGGCAACTGGCATCATAGTTGCAGGTGGGACTGCTGCATACATGCATTCACAGAGCAGGGTTAGAAGGCCAAGTGGCACTAGTCAACACAATGGATTAGGAGACGATAATGAAAGAGTGGGATTGGATAAGAGTGTTATTAAAAAAAGCAGACAAAAGAAAGGACTGAAATCACTCCAAGT...

Protein

Download Protein FASTA

1363 aa · LXL04_021466|LXL04_021466|OH1004|PROTEIN

MTSLQLLQLTERGRSLLSSGRRKTLLLATGIIVAGGTAAYMHSQSRVRRPSGTSQHNGLGDDNERVGLDKSVIKKSRQKKGLKSLQVLAAILLSHMGKLGAKDLLALLATVVLRTAVSNRLAKVQGFLFRAAFLRRVPTFVQLIIENIILCFVQSALYSTSKYITGTLSLRFRKILTKLIHAQYFQNMIYYKMSHVDGRITNPEQRIASDVPKFCSELSDLIQEDLTAVTDGLLYSWRLCSYASPKYIVWILAYVLGAGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021466`
TK1151 ID	TkA05G398140
OH-1004 ID	LXL04_021466
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021466

Location Chr04:130699670-130706118 (-)

Description Similar to ABCD1: ABC transporter D family member 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39850`	Contributes to the transport of fatty acids and their derivatives (acyl CoAs) across the peroxisomal membrane.	Ped3p is a peroxisomal ATP-binding cassette transporter that might supply substrates for fatty acid beta-oxidation.2002 · DOI: 10.1093/pcp/pcf023 Acetate non-utilizing mutants of Arabidopsis: evidence that organic acids influence carbohydrate perception in germinating seedlings.2004 · DOI: 10.1007/s00438-004-0985-9 The Arabidopsis ALDP protein homologue COMATOSE is instrumental in peroxisomal acetate metabolism.2007 · DOI: 10.1042/bj20070258 2,4-Dichlorophenoxybutyric acid-resistant mutants of Arabidopsis have defects in glyoxysomal fatty acid beta-oxidation.1998 · DOI: 10.1105/tpc.10.2.183

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021466 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000038 very long-chain fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0006869 lipid transport Biological Process

GO:0007031 peroxisome organization Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0015721 bile acid and bile salt transport Biological Process

GO:0015910 long-chain fatty acid import into peroxisome Biological Process

GO:0015916 fatty-acyl-CoA transport Biological Process

GO:0016042 lipid catabolic process Biological Process

KEGG gene cross-reference

ath:AT4G39850

mmu:19299

rno:25270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.466

Rank 1 · LXL04_021466 · OH-1004

Peroxisome0.432

Rank 2 · LXL04_021466 · OH-1004

Cytoplasm0.083

Rank 3 · LXL04_021466 · OH-1004

Nucleus0.050

Rank 4 · LXL04_021466 · OH-1004

Endoplasmic reticulum0.044

Rank 5 · LXL04_021466 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06472.21ABC_membrane_288-356 aa

PF00005.34ABC_tran460-605 aa

PF06472.21ABC_membrane_2741-1007 aa

PF00005.34ABC_tran1140-1309 aa

PF13304.13AAA_211153-1177 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021466	`PF06472.21`	ABC_membrane_2	88	356	2.1e-170	565.8
LXL04_021466	`PF00005.34`	ABC_tran	460	605	9.4e-37	127.4
LXL04_021466	`PF06472.21`	ABC_membrane_2	741	1007	2.1e-170	565.8
LXL04_021466	`PF00005.34`	ABC_tran	1140	1309	9.4e-37	127.4
LXL04_021466	`PF13304.13`	AAA_21	1153	1177	3.1e-10	41.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94FB9`	Arabidopsis thaliana	ABC transporter D family member 1	74.636%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card