LXL04_021419 | RubberDandelionOmics

Gene overview

LXL04_021419

Reference: OH-1004 Chr: Chr04 Coordinates: 129433962-129435728 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1521 bp · LXL04_021419|LXL04_021419|OH1004|cDNA

ATGCAAACCGTTTGTTTCAACTCAAATGTAACACTTGGTTCTAGACATATCTTATCTTTACCATTCAATCACACCTCCTACatgttcgatgaaatgtctgaAAGAAGCCGAATAATATCTTCATCGCGAAAGTGTTGTTGCTGCTATTCTGCTGCCAATATATCAATGTGTAATAGATTGATTGCAATAAGCCCTTGCTTTCGTCAATCGACTTTGTATCAATGGTCGCTTACTAAAACACTACTCTTTCATGGTACTAG...

CDS

Download CDS FASTA

1521 bp · LXL04_021419|LXL04_021419|OH1004|CDS

ATGCAAACCGTTTGTTTCAACTCAAATGTAACACTTGGTTCTAGACATATCTTATCTTTACCATTCAATCACACCTCCTACATGTTCGATGAAATGTCTGAAAGAAGCCGAATAATATCTTCATCGCGAAAGTGTTGTTGCTGCTATTCTGCTGCCAATATATCAATGTGTAATAGATTGATTGCAATAAGCCCTTGCTTTCGTCAATCGACTTTGTATCAATGGTCGCTTACTAAAACACTACTCTTTCATGGTACTAG...

Protein

Download Protein FASTA

506 aa · LXL04_021419|LXL04_021419|OH1004|PROTEIN

MQTVCFNSNVTLGSRHILSLPFNHTSYMFDEMSERSRIISSSRKCCCCYSAANISMCNRLIAISPCFRQSTLYQWSLTKTLLFHGTSSRGFYTVSSFTDRNYHHEKLSSFNEKRKQRAFGHKRKKQFLCNASDDYVNDVEVMLSLLTDEVNLDPKKIDKKQIICNNKEKKNICSGIVNKDPKCNNEKGKISEKKDIEKGYRNKSEKKLIEEVSSLNCEEISTEVSNTIKEMNKEKHQKTNHLNFTTTVSNEKSQVHDSDI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021419`
TK1151 ID	TkA05G389450
OH-1004 ID	LXL04_021419
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021419

Location Chr04:129433962-129435728 (-)

Description Similar to TADA: tRNA(adenine(34)) deaminase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68720`	Deaminates adenosines to inosines in tRNA-Arg(ACG).	Identification of the chloroplast adenosine-to-inosine tRNA editing enzyme.2009 · DOI: 10.1261/rna.1600609 Arabidopsis tRNA adenosine deaminase arginine edits the wobble nucleotide of chloroplast tRNAArg(ACG) and is essential for efficient chloroplast translation.2009 · DOI: 10.1105/tpc.109.066654

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021419 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002100 tRNA wobble adenosine to inosine editing Biological Process

GO:0010311 lateral root formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008251 tRNA-specific adenosine deaminase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0052717 tRNA-specific adenosine-34 deaminase activity Molecular Function

KEGG gene cross-reference

ath:AT1G68720

bsu:BSU00180

spa:M6_Spy0214

spg:SpyM3_0153

sps:SPs0158

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.599

Rank 1 · LXL04_021419 · OH-1004

Mitochondrion0.312

Rank 2 · LXL04_021419 · OH-1004

Nucleus0.079

Rank 3 · LXL04_021419 · OH-1004

Cytoplasm0.070

Rank 4 · LXL04_021419 · OH-1004

Cell membrane0.025

Rank 5 · LXL04_021419 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00383.30dCMP_cyt_deam_1298-396 aa

PF14437.13MafB19-deam299-399 aa

PF14439.13Bd3614-deam322-388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021419	`PF00383.30`	dCMP_cyt_deam_1	298	396	3.1e-30	104.8
LXL04_021419	`PF14437.13`	MafB19-deam	299	399	4.1e-27	95.4
LXL04_021419	`PF14439.13`	Bd3614-deam	322	388	1.2e-06	29.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S7I0`	Arabidopsis thaliana	tRNA(adenine(34)) deaminase, chloroplastic	70.879%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card