LXL04_021415 | RubberDandelionOmics

Gene overview

LXL04_021415

Reference: OH-1004 Chr: Chr04 Coordinates: 129389938-129395535 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3138 bp · LXL04_021415|LXL04_021415|OH1004|cDNA

ATGACGGACATAACGGACGATATAGCAGAGGAGATTTCGTTTCAGAGCTACGATGATGATCTACGCCTTCTCTTCAGTCTCCTCCACGACGTTCTCCAACGGGAAGTAGGTCCCAGTATCATGGAAAAAATCGAGCATGCTCGTACTCTGTCTCAGAGCGCATGTCTTTTAAGAGGATCTGGGATTGAAGGCACTGCAGAGGTGCTTGAAAAACAATTAGCAAATGAGTTATCAAAGATGACTTTAGAGGAAGCCTTGAA...

CDS

Download CDS FASTA

3138 bp · LXL04_021415|LXL04_021415|OH1004|CDS

ATGACGGACATAACGGACGATATAGCAGAGGAGATTTCGTTTCAGAGCTACGATGATGATCTACGCCTTCTCTTCAGTCTCCTCCACGACGTTCTCCAACGGGAAGTAGGTCCCAGTATCATGGAAAAAATCGAGCATGCTCGTACTCTGTCTCAGAGCGCATGTCTTTTAAGAGGATCTGGGATTGAAGGCACTGCAGAGGTGCTTGAAAAACAATTAGCAAATGAGTTATCAAAGATGACTTTAGAGGAAGCCTTGAA...

Protein

Download Protein FASTA

1045 aa · LXL04_021415|LXL04_021415|OH1004|PROTEIN

MTDITDDIAEEISFQSYDDDLRLLFSLLHDVLQREVGPSIMEKIEHARTLSQSACLLRGSGIEGTAEVLEKQLANELSKMTLEEALKLARALSHFLNLMGIAETHHRTRKAKNVAQASKSCDDTFNQLIQGGFSPDVLYDTVCKQAVEIVLTAHPTQINRRTLQYKHIRISHLLEYNDRKDLTQEDQDTLIEDLVREITSIWQTDELRRHKPTPVDEARAGLNYVESSLWRAVPHYLRRLSNALKKHTGRPLPLTCTPIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021415`
TK1151 ID	TkA05G389340
OH-1004 ID	LXL04_021415
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021415

Location Chr04:129389938-129395535 (+)

Description Similar to PPC4: Phosphoenolpyruvate carboxylase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68750`	Through the carboxylation of phosphoenolpyruvate (PEP) it forms oxaloacetate, a four-carbon dicarboxylic acid source for the tricarboxylic acid cycle.	No verified direct reference in this release
`At2g42600`	Through the carboxylation of phosphoenolpyruvate (PEP) it forms oxaloacetate, a four-carbon dicarboxylic acid source for the tricarboxylic acid cycle.	No verified direct reference in this release
`At3g14940`	Through the carboxylation of phosphoenolpyruvate (PEP) it forms oxaloacetate, a four-carbon dicarboxylic acid source for the tricarboxylic acid cycle.	No verified direct reference in this release
`At1g53310`	Through the carboxylation of phosphoenolpyruvate (PEP) it forms oxaloacetate, a four-carbon dicarboxylic acid source for the tricarboxylic acid cycle.	In vivo regulatory phosphorylation of the phosphoenolpyruvate carboxylase AtPPC1 in phosphate-starved Arabidopsis thaliana.2009 · DOI: 10.1042/bj20082397

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021415 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0015977 carbon fixation Biological Process

GO:0015979 photosynthesis Biological Process

GO:0048366 leaf development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0008964 phosphoenolpyruvate carboxylase activity Molecular Function

KEGG gene cross-reference

ath:AT1G68750

ath:AT2G42600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.430

Rank 1 · LXL04_021415 · OH-1004

Plastid0.245

Rank 2 · LXL04_021415 · OH-1004

Mitochondrion0.196

Rank 3 · LXL04_021415 · OH-1004

Peroxisome0.155

Rank 4 · LXL04_021415 · OH-1004

Nucleus0.109

Rank 5 · LXL04_021415 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00311.24PEPcase19-340 aa

PF00311.24PEPcase458-1045 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021415	`PF00311.24`	PEPcase	19	340		1052.5
LXL04_021415	`PF00311.24`	PEPcase	458	1045		1052.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GVE8`	Arabidopsis thaliana	Phosphoenolpyruvate carboxylase 4	71.578%	Swiss-Prot	strong database homology
`Q5GM68`	Arabidopsis thaliana	Phosphoenolpyruvate carboxylase 2	48.622%	Swiss-Prot	moderate database homology
`Q84VW9`	Arabidopsis thaliana	Phosphoenolpyruvate carboxylase 3	48.788%	Swiss-Prot	moderate database homology
`Q9MAH0`	Arabidopsis thaliana	Phosphoenolpyruvate carboxylase 1	48.382%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card