LXL04_021389 | RubberDandelionOmics

Gene overview

LXL04_021389

Reference: OH-1004 Chr: Chr04 Coordinates: 128650517-128653346 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

729 bp · LXL04_021389|LXL04_021389|OH1004|cDNA

ATGAGTCTATCAGTTGTTCAAGGGTTTAGCAAGTCTCTTGCGATGACTGTGCTCTCTGAAATTGGCGACAAGACATTTTTCGCAGCTGCGATTTTGGCGATGCGTCATCCCAGGAGATATGTTCTGGCAGGCTGCCTTTCAGCTTTGATTGTCATGACTATTCTCTCTGCTGCTGTTGGCTGGGCTGCTCCTAACCTGATCTCGCGAACATTGACCAAGCATATCGCGACTATTTTGTTTTTAGGGTTTGGAGTTTGGTC...

CDS

Download CDS FASTA

729 bp · LXL04_021389|LXL04_021389|OH1004|CDS

ATGAGTCTATCAGTTGTTCAAGGGTTTAGCAAGTCTCTTGCGATGACTGTGCTCTCTGAAATTGGCGACAAGACATTTTTCGCAGCTGCGATTTTGGCGATGCGTCATCCCAGGAGATATGTTCTGGCAGGCTGCCTTTCAGCTTTGATTGTCATGACTATTCTCTCTGCTGCTGTTGGCTGGGCTGCTCCTAACCTGATCTCGCGAACATTGACCAAGCATATCGCGACTATTTTGTTTTTAGGGTTTGGAGTTTGGTC...

Protein

Download Protein FASTA

242 aa · LXL04_021389|LXL04_021389|OH1004|PROTEIN

MSLSVVQGFSKSLAMTVLSEIGDKTFFAAAILAMRHPRRYVLAGCLSALIVMTILSAAVGWAAPNLISRTLTKHIATILFLGFGVWSLWDAFHEGESEELAEVEAELDADLQANGKTKSNGKADDDDKKKKRPLFSQFFSPIFLKAFSITFFGEWGDKSQIATIGLAAAENPLGVVLGGILGQALCQTAAVFGGKSLAKQISEKFIALSGGVLFIVFGIQSYFSTMDNPKNELESTQSELMN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021389`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021389

Location Chr04:128650517-128653346 (+)

Description Similar to At1g25520: GDT1-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g25520`	GDT1-like protein 4.	No verified direct reference in this release
`At1g68650`	GDT1-like protein 5.	No verified direct reference in this release
`At5g36290`	GDT1-like protein 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0433100`	GDT1-like protein 5.	No verified direct reference in this release
`UniProt: A2YXC7`	GDT1-like protein 4.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021389 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006828 manganese ion transport Biological Process

GO:0032468 Golgi calcium ion homeostasis Biological Process

GO:0032472 Golgi calcium ion transport Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0071421 manganese ion transmembrane transport Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0035618 root hair Cellular Component

GO:1990676 Golgi trans cisterna membrane Cellular Component

KEGG gene cross-reference

ath:AT1G25520

ath:AT1G68650

ath:AT5G36290

dosa:Os08g0433100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.326

Rank 1 · LXL04_021389 · OH-1004

Lysosome / Vacuole0.253

Rank 2 · LXL04_021389 · OH-1004

Endoplasmic reticulum0.205

Rank 3 · LXL04_021389 · OH-1004

Cytoplasm0.156

Rank 4 · LXL04_021389 · OH-1004

Cell membrane0.118

Rank 5 · LXL04_021389 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01169.26GDT19-93 aa

PF01169.26GDT1143-226 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021389	`PF01169.26`	GDT1	9	93	8.3e-50	167.7
LXL04_021389	`PF01169.26`	GDT1	143	226	8.3e-50	167.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C6M1`	Arabidopsis thaliana	GDT1-like protein 4	74.890%	Swiss-Prot	strong database homology
`Q9SX28`	Arabidopsis thaliana	GDT1-like protein 5	74.667%	Swiss-Prot	strong database homology
`Q93Y38`	Arabidopsis thaliana	GDT1-like protein 3	44.091%	Swiss-Prot	moderate database homology
`B9G125`	Oryza sativa subsp. japonica	GDT1-like protein 5	69.787%	Swiss-Prot	strong database homology
`A2YXC7`	Oryza sativa subsp. indica	GDT1-like protein 4	45.249%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card