LXL04_020749 | RubberDandelionOmics

Gene overview

LXL04_020749

Reference: OH-1004 Chr: Chr04 Coordinates: 107755198-107759766 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2682 bp · LXL04_020749|LXL04_020749|OH1004|cDNA

ATGTCTCTTGCACCTCCAGCCACGCCTTTCCCGGCGGCCATGGTGGTGGATTTCCCACCAAAGAAGCTTCACTTTCCCGTTAAAACACTTAAGATTGGATTAATTTTGGTTTGGCTGTGTGGGTTTATCCTTTTTTCAATTTCCTTCTATGCCACTACTCAAATATtgccttcttcttcttcttcttcttcttcttcttcttctattAAAGAGCAAATCAATAACATCACTGGTTCAAAGAGGCCCACTGTTACAATATT...

CDS

Download CDS FASTA

2682 bp · LXL04_020749|LXL04_020749|OH1004|CDS

ATGTCTCTTGCACCTCCAGCCACGCCTTTCCCGGCGGCCATGGTGGTGGATTTCCCACCAAAGAAGCTTCACTTTCCCGTTAAAACACTTAAGATTGGATTAATTTTGGTTTGGCTGTGTGGGTTTATCCTTTTTTCAATTTCCTTCTATGCCACTACTCAAATATTGCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTATTAAAGAGCAAATCAATAACATCACTGGTTCAAAGAGGCCCACTGTTACAATATT...

Protein

Download Protein FASTA

893 aa · LXL04_020749|LXL04_020749|OH1004|PROTEIN

MSLAPPATPFPAAMVVDFPPKKLHFPVKTLKIGLILVWLCGFILFSISFYATTQILPSSSSSSSSSSSIKEQINNITGSKRPTVTIFTAVRPFCGSIGRKQTLAIRSWLGLSQDIRVVLFTQDPSGFSFAGSFGPGSRVSVEPTIDFTFLGTPFFHSMIARAQASNSDISVVMDSETILLPDFFSTLSYVHKLDHDWLLIASSKNVSDFPFELDVDGKHWVGDNGKRVGTKKLQDFLSHGQWEDCVDKKMIMAWNNGDLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020749`
TK1151 ID	TkA05G302020
OH-1004 ID	LXL04_020749
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.800
Protein coverage (%)	TK1151 99.413 / OH-1004 76.596 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020749

Location Chr04:107755198-107759766 (+)

Description Similar to RAY1: Beta-arabinofuranosyltransferase RAY1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70630`	Beta-arabinofuranosyltransferase that transfers specifically an arabinosyl residue from UDP-arabinofuranose to the monosaccharide galactose or beta-methyl-galactoside in vitro.	No verified direct reference in this release
`At2g35610`	Plays a role in the arabinosylation of cell wall components.	Identification of plant cell wall mutants by means of a forward chemical genetic approach using hydrolases.2009 · DOI: 10.1073/pnas.0905434106 Cell wall properties play an important role in the emergence of lateral root primordia from the parent root.2014 · DOI: 10.1093/jxb/eru056
`At1g56550`	Catalyzes the transfer of D-xylose from UDP-alpha-D-xylose onto L-fucose.	Functional characterisation of a putative rhamnogalacturonan II specific xylosyltransferase.2008 · DOI: 10.1016/j.febslet.2008.08.015
`At4g01220`	Catalyzes the transfer of D-xylose from UDP-alpha-D-xylose onto L-fucose.	Male gametophyte defective 4 encodes a rhamnogalacturonan II xylosyltransferase and is important for growth of pollen tubes and roots in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04452.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020749 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010265 SCF complex assembly Biological Process

GO:0010306 rhamnogalacturonan II biosynthetic process Biological Process

GO:0031506 cell wall glycoprotein biosynthetic process Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0043687 post-translational protein modification Biological Process

GO:0048868 pollen tube development Biological Process

GO:0052325 cell wall pectin biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0080147 root hair cell development Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G56550

ath:AT1G70630

ath:AT2G35610

ath:AT4G01220

ddi:DDB_G0283005

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.563

Rank 1 · LXL04_020749 · OH-1004

Cell membrane0.117

Rank 2 · LXL04_020749 · OH-1004

Endoplasmic reticulum0.101

Rank 3 · LXL04_020749 · OH-1004

Cytoplasm0.062

Rank 4 · LXL04_020749 · OH-1004

Nucleus0.058

Rank 5 · LXL04_020749 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03407.23Nucleotid_trans460-680 aa

PF14009.13PADRE739-890 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020749	`PF03407.23`	Nucleotid_trans	460	680	1.5e-45	156.4
LXL04_020749	`PF14009.13`	PADRE	739	890	4e-19	70.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I6V0`	Arabidopsis thaliana	Beta-arabinofuranosyltransferase RAY1	58.845%	Swiss-Prot	moderate database homology
`Q8VXZ5`	Arabidopsis thaliana	Arabinosyltransferase XEG113	31.250%	Swiss-Prot	weak database homology
`Q9FXA7`	Arabidopsis thaliana	UDP-D-xylose:L-fucose alpha-1,3-D-xylosyltransferase 3	22.472%	Swiss-Prot	weak database homology
`Q9M146`	Arabidopsis thaliana	UDP-D-xylose:L-fucose alpha-1,3-D-xylosyltransferase MGP4	22.140%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card