LXL04_020065 | RubberDandelionOmics

Gene overview

LXL04_020065

Reference: OH-1004 Chr: Chr04 Coordinates: 50463651-50465527 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1116 bp · LXL04_020065|LXL04_020065|OH1004|cDNA

ATGGCACTTTCCGTACTCCCACCATCGAAATGTGGCTGCCATTATCAGTTTTACAGGACAAGGATAACTCAACAAAGAACGCGAAATTCCGCCATGATTATCCGGATGACGGCGTCAAGTGGAGGAGGAACAGGGGGTCGATTGGCGTCGTACGAAGAAGGGGAACTGGAAAGACCTAACTGGACAGGTCAAACCCCTCTTTCTCGCCTTGTTGCTGCCCTAATTTCATTCAAACCTCTCTATTCTGTGCTCAAACTTGG...

CDS

Download CDS FASTA

1116 bp · LXL04_020065|LXL04_020065|OH1004|CDS

ATGGCACTTTCCGTACTCCCACCATCGAAATGTGGCTGCCATTATCAGTTTTACAGGACAAGGATAACTCAACAAAGAACGCGAAATTCCGCCATGATTATCCGGATGACGGCGTCAAGTGGAGGAGGAACAGGGGGTCGATTGGCGTCGTACGAAGAAGGGGAACTGGAAAGACCTAACTGGACAGGTCAAACCCCTCTTTCTCGCCTTGTTGCTGCCCTAATTTCATTCAAACCTCTCTATTCTGTGCTCAAACTTGG...

Protein

Download Protein FASTA

371 aa · LXL04_020065|LXL04_020065|OH1004|PROTEIN

MALSVLPPSKCGCHYQFYRTRITQQRTRNSAMIIRMTASSGGGTGGRLASYEEGELERPNWTGQTPLSRLVAALISFKPLYSVLKLGARQVLISTAEKTNVPWREMTKEILESDVYKEMESIENPSIVYPDYYLSPFHAYDEGNLSWLAAAEAEAATMSMVRRAIPDASSLDEANEIVRGNWLNAIEKHHQHYSGNLEIRDILDIGCSVGVSTRFLAHKFPSAKLTGLDLSPYFLAVAQYKEKRRNSRSNSIEWIHANGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020065`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_020065`
Location	Chr04:50463651-50465527 (+)
Description	Similar to coq-5: 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020065` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006744 ubiquinone biosynthetic process Biological Process GO:0009234 menaquinone biosynthetic process Biological Process GO:0017000 antibiotic biosynthetic process Biological Process GO:0032259 methylation Biological Process GO:0042372 phylloquinone biosynthetic process Biological Process GO:0031314 extrinsic component of mitochondrial inner membrane Cellular Component GO:0008425 2-methoxy-6-polyprenyl-1,4-benzoquinol methyltransferase activity Molecular Function GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function GO:0043770 demethylmenaquinone methyltransferase activity Molecular Function GO:0052624 2-phytyl-1,4-naphthoquinone methyltransferase activity Molecular Function GO:0102307 erythromycin 3''-o-methyltransferase activity Molecular Function
KEGG gene cross-reference	cel:CELE_ZK652.9 oih:OB1789 sen:SACE_0728 tel:tll2373 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.970

Rank 1 · LXL04_020065 · OH-1004

Mitochondrion0.038

Rank 2 · LXL04_020065 · OH-1004

Nucleus0.015

Rank 3 · LXL04_020065 · OH-1004

Cytoplasm0.014

Rank 4 · LXL04_020065 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_020065 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01209.25Ubie_methyltran182-311 aa

PF05175.21MTS199-310 aa

PF13489.13Methyltransf_23200-354 aa

PF13649.13Methyltransf_25202-301 aa

PF13847.13Methyltransf_31202-309 aa

PF08241.19Methyltransf_11203-305 aa

PF08242.19Methyltransf_12203-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020065	`PF01209.25`	Ubie_methyltran	182	311	1.1e-15	58.3
LXL04_020065	`PF05175.21`	MTS	199	310	1.7e-06	28.4
LXL04_020065	`PF13489.13`	Methyltransf_23	200	354	1e-08	35.8
LXL04_020065	`PF13649.13`	Methyltransf_25	202	301	5e-19	69.5
LXL04_020065	`PF13847.13`	Methyltransf_31	202	309	1.1e-10	42.2
LXL04_020065	`PF08241.19`	Methyltransf_11	203	305	8.3e-19	68.7
LXL04_020065	`PF08242.19`	Methyltransf_12	203	303	1.6e-15	58.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card