LXL04_019282 | RubberDandelionOmics

Gene overview

LXL04_019282

Reference: OH-1004 Chr: Chr04 Coordinates: 28084088-28084567 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

480 bp · LXL04_019282|LXL04_019282|OH1004|cDNA

ATGTCCTCCTCGAGTCAGACCAACACAACTGACTCTTCATCACCTGGAGAAACTGGCTTCGATACCAACACCATTGTAGTTCTAGCAGCCTTATTATGTGCACTTGTAGCTTCACTTGCACTCAACTCAGTCATACAATATGCGTTACGACATAGGCGTGAATCCTTAGAAGCAGCAGCTGCCATGGCCTCACGATCTCAGAAACATACCATAAAGAAGATTCATGTGGAAGTATTTGGGTCAGGAGCAGAGATTCAGGC...

CDS

Download CDS FASTA

480 bp · LXL04_019282|LXL04_019282|OH1004|CDS

ATGTCCTCCTCGAGTCAGACCAACACAACTGACTCTTCATCACCTGGAGAAACTGGCTTCGATACCAACACCATTGTAGTTCTAGCAGCCTTATTATGTGCACTTGTAGCTTCACTTGCACTCAACTCAGTCATACAATATGCGTTACGACATAGGCGTGAATCCTTAGAAGCAGCAGCTGCCATGGCCTCACGATCTCAGAAACATACCATAAAGAAGATTCATGTGGAAGTATTTGGGTCAGGAGCAGAGATTCAGGC...

Protein

Download Protein FASTA

159 aa · LXL04_019282|LXL04_019282|OH1004|PROTEIN

MSSSSQTNTTDSSSPGETGFDTNTIVVLAALLCALVASLALNSVIQYALRHRRESLEAAAAMASRSQKHTIKKIHVEVFGSGAEIQASECSICLGDFVDGEKVRVLPQCNHEFHVKCVDKWLVDHMSCPNCRRLVALLPEGERAAGNQSEYDSVLNFMV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019282`
TK1151 ID	TkA05G037870
OH-1004 ID	LXL04_019282
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019282

Location Chr04:28084088-28084567 (+)

Description Similar to ATL72: RING-H2 finger protein ATL72

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10910`	RING-H2 finger protein ATL72.	No verified direct reference in this release
`At5g05280`	RING-H2 finger protein ATL73.	No verified direct reference in this release
`At5g01880`	RING-H2 finger protein ATL74.	No verified direct reference in this release
`At1g49230`	RING-H2 finger protein ATL78.	No verified direct reference in this release
`At2g17450`	E3 ubiquitin-protein ligase that possess E3 ubiquitin ligase activity in vitro and mediates protein monoubiquitination.	Ligand-induced monoubiquitination of BIK1 regulates plant immunity.2020 · DOI: 10.1038/s41586-020-2210-3

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019282 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006513 protein monoubiquitination Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009555 pollen development Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0048443 stamen development Biological Process

GO:0048481 plant ovule development Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0080141 regulation of jasmonic acid biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G49230

ath:AT2G17450

ath:AT3G10910

ath:AT5G01880

ath:AT5G05280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.411

Rank 1 · LXL04_019282 · OH-1004

Lysosome / Vacuole0.271

Rank 2 · LXL04_019282 · OH-1004

Endoplasmic reticulum0.200

Rank 3 · LXL04_019282 · OH-1004

Cytoplasm0.168

Rank 4 · LXL04_019282 · OH-1004

Golgi apparatus0.121

Rank 5 · LXL04_019282 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_289-132 aa

PF17123.12zf-RING_1189-118 aa

PF13923.13zf-C3HC4_289-131 aa

PF00097.32zf-C3HC490-131 aa

PF12678.14zf-rbx1103-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019282	`PF13639.13`	zf-RING_2	89	132	4e-14	53.3
LXL04_019282	`PF17123.12`	zf-RING_11	89	118	1.2e-12	48.0
LXL04_019282	`PF13923.13`	zf-C3HC4_2	89	131	1.4e-07	31.9
LXL04_019282	`PF00097.32`	zf-C3HC4	90	131	6.8e-06	26.6
LXL04_019282	`PF12678.14`	zf-rbx1	103	132	1.1e-06	29.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SG96`	Arabidopsis thaliana	RING-H2 finger protein ATL72	40.116%	Swiss-Prot	moderate database homology
`Q9FLC6`	Arabidopsis thaliana	RING-H2 finger protein ATL73	44.604%	Swiss-Prot	moderate database homology
`Q9LZV8`	Arabidopsis thaliana	RING-H2 finger protein ATL74	47.887%	Swiss-Prot	moderate database homology
`Q6NQG7`	Arabidopsis thaliana	RING-H2 finger protein ATL78	41.791%	Swiss-Prot	moderate database homology
`O22755`	Arabidopsis thaliana	Probable E3 ubiquitin-protein ligase ATL44	39.837%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card