LXL04_019244 | RubberDandelionOmics

Gene overview

LXL04_019244

Reference: OH-1004 Chr: Chr04 Coordinates: 27135204-27139337 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2007 bp · LXL04_019244|LXL04_019244|OH1004|cDNA

ATGTTGCAAGAAAACGGAGATATGAAATCTACAAGTAAGAGCCTGGGTTCAATGTATGGGCTGGAACAACACCAAATTAGCATGAATATGGCTTCATTAGATCTCCCTCCACCACGACCACCGTTGAGTCTACCTCGTTCAGATCTTCTTGTCGGAAACAGAGAAGACTACAATGAGATTTGTGTTCCTACATATAAAGCAACAATCACCGGCGATTGGAAAGCGGCAAAAAACATTCTCGACAAACGGCCGGAGCTGGT...

CDS

Download CDS FASTA

2007 bp · LXL04_019244|LXL04_019244|OH1004|CDS

ATGTTGCAAGAAAACGGAGATATGAAATCTACAAGTAAGAGCCTGGGTTCAATGTATGGGCTGGAACAACACCAAATTAGCATGAATATGGCTTCATTAGATCTCCCTCCACCACGACCACCGTTGAGTCTACCTCGTTCAGATCTTCTTGTCGGAAACAGAGAAGACTACAATGAGATTTGTGTTCCTACATATAAAGCAACAATCACCGGCGATTGGAAAGCGGCAAAAAACATTCTCGACAAACGGCCGGAGCTGGT...

Protein

Download Protein FASTA

668 aa · LXL04_019244|LXL04_019244|OH1004|PROTEIN

MLQENGDMKSTSKSLGSMYGLEQHQISMNMASLDLPPPRPPLSLPRSDLLVGNREDYNEICVPTYKATITGDWKAAKNILDKRPELVRFSITESGETVLHIAVMGKSYWFVEYLVSLMNKEDLELQNQKGQTALCLAAIAGNVKIAMFLVKKNRALLDIPDNRGMMPLYMAALFGKHDMVTYLYQSSRKMIGDFWTHQLRGGVLVKCVEANLFDVALQIVRDRPELAVNGSVLALLARKPYAFDATTPHIIWRIICSLCR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019244`
TK1151 ID	TkA05G033120
OH-1004 ID	LXL04_019244
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019244

Location Chr04:27135204-27139337 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12360`	Involved in salt stress tolerance.	ITN1, a novel gene encoding an ankyrin-repeat protein that affects the ABA-mediated production of reactive oxygen species and is involved in salt-stress tolerance in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1365-313x.2008.03614.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0837000`	Involved in salt stress tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019244 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002027 regulation of heart rate Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006396 RNA processing Biological Process

GO:0007165 signal transduction Biological Process

GO:0009651 response to salt stress Biological Process

GO:0055117 regulation of cardiac muscle contraction Biological Process

GO:0071222 cellular response to lipopolysaccharide Biological Process

GO:0086069 bundle of His cell to Purkinje myocyte communication Biological Process

GO:1903779 regulation of cardiac conduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT3G12360

dosa:Os01g0837000

hsa:4793

mmu:435766

rbe:RBE_0151

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.887

Rank 1 · LXL04_019244 · OH-1004

Cytoplasm0.077

Rank 2 · LXL04_019244 · OH-1004

Endoplasmic reticulum0.069

Rank 3 · LXL04_019244 · OH-1004

Nucleus0.036

Rank 4 · LXL04_019244 · OH-1004

Lysosome / Vacuole0.023

Rank 5 · LXL04_019244 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12796.14Ank_299-186 aa

PF13857.13Ank_5121-168 aa

PF13637.13Ank_4134-183 aa

PF13962.12PGG500-609 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019244	`PF12796.14`	Ank_2	99	186	2.3e-21	76.9
LXL04_019244	`PF13857.13`	Ank_5	121	168	7.8e-09	36.4
LXL04_019244	`PF13637.13`	Ank_4	134	183	3.1e-13	50.3
LXL04_019244	`PF13962.12`	PGG	500	609	4.1e-22	78.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7A2`	Arabidopsis thaliana	Ankyrin repeat-containing protein ITN1	22.118%	Swiss-Prot	weak database homology
`A2CIR5`	Oryza sativa subsp. japonica	Ankyrin repeat-containing protein NPR4	21.739%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card