LXL04_019149 | RubberDandelionOmics

Gene overview

LXL04_019149

Reference: OH-1004 Chr: Chr04 Coordinates: 24714249-24715599 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · LXL04_019149|LXL04_019149|OH1004|cDNA

ATGAAAGACATTCAAACCAAGAAATTAGCTCTTTTAGTAGGGTGCAACTATGCAAACACACCAAATGAGTTACATGGTTGCATAAATGATGTGTTAGCCATTAGACAAGTCCTCATTAGCCGATTTGGGTTCGACCCAACCCACATCCAGCTTCTAACTGATGCACCTGGCTCGCTTGTCATGCCAACCGGTGCAAATATAAAGGATGCACTTATCAGTATGGTTGACCAAGCTGAGCCAGGTGACATTCTTTACTTTCA...

CDS

Download CDS FASTA

939 bp · LXL04_019149|LXL04_019149|OH1004|CDS

ATGAAAGACATTCAAACCAAGAAATTAGCTCTTTTAGTAGGGTGCAACTATGCAAACACACCAAATGAGTTACATGGTTGCATAAATGATGTGTTAGCCATTAGACAAGTCCTCATTAGCCGATTTGGGTTCGACCCAACCCACATCCAGCTTCTAACTGATGCACCTGGCTCGCTTGTCATGCCAACCGGTGCAAATATAAAGGATGCACTTATCAGTATGGTTGACCAAGCTGAGCCAGGTGACATTCTTTACTTTCA...

Protein

Download Protein FASTA

312 aa · LXL04_019149|LXL04_019149|OH1004|PROTEIN

MKDIQTKKLALLVGCNYANTPNELHGCINDVLAIRQVLISRFGFDPTHIQLLTDAPGSLVMPTGANIKDALISMVDQAEPGDILYFHYSGHGTRIPSIKRPHTFHHPDEAIVPCDFNLITDMDFRNIVDRVPKGATFTILSDSCHSGGLIDKEKEQIGPSSSIQSSNSTPTTTKPKTIPFNSILLHLSSLTHINTPDHSTHFLELFGDTASLRFRFPSHELDSIPSLHEDNGILLSGCQANESSADMNPNGDKGKAYGAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019149`
TK1151 ID	TkA05G023350
OH-1004 ID	LXL04_019149
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.600
Protein coverage (%)	TK1151 33.523 / OH-1004 18.910 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019149

Location Chr04:24714249-24715599 (-)

Description Similar to AMC9: Metacaspase-9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04200`	Cysteine protease that cleaves specifically after arginine or lysine residues.	No verified direct reference in this release
`At1g79320`	Metacaspase-6.	No verified direct reference in this release
`At1g16420`	Cysteine protease that cleaves specifically after arginine residues.	No verified direct reference in this release
`At1g79330`	Cysteine protease that cleaves specifically after arginine or lysine residues.	Two Arabidopsis metacaspases AtMCP1b and AtMCP2b are arginine/lysine-specific cysteine proteases and activate apoptosis-like cell death in yeast.2005 · DOI: 10.1074/jbc.m413527200
`At1g79340`	Cysteine protease that cleaves specifically after arginine or lysine residues.	Calcium-dependent activation and autolysis of Arabidopsis metacaspase 2d.2011 · DOI: 10.1074/jbc.m110.194340 Arabidopsis metacaspase 2d is a positive mediator of cell death induced during biotic and abiotic stresses.2011 · DOI: 10.1111/j.1365-313x.2011.04554.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019149 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0010225 response to UV-C Biological Process

GO:0010421 hydrogen peroxide-mediated programmed cell death Biological Process

GO:0012501 programmed cell death Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT1G16420

ath:AT1G79320

ath:AT1G79330

ath:AT5G04200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.572

Rank 1 · LXL04_019149 · OH-1004

Nucleus0.303

Rank 2 · LXL04_019149 · OH-1004

Lysosome / Vacuole0.107

Rank 3 · LXL04_019149 · OH-1004

Mitochondrion0.086

Rank 4 · LXL04_019149 · OH-1004

Peroxisome0.076

Rank 5 · LXL04_019149 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00656.28Peptidase_C147-302 aa

PF31181.1Pept_C14_Metacaspase8-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019149	`PF00656.28`	Peptidase_C14	7	302	4.2e-35	122.2
LXL04_019149	`PF31181.1`	Pept_C14_Metacaspase	8	151	3.3e-35	122.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FYE1`	Arabidopsis thaliana	Metacaspase-9	60.312%	Swiss-Prot	strong database homology
`O64519`	Arabidopsis thaliana	Metacaspase-6	38.630%	Swiss-Prot	moderate database homology
`Q9SA41`	Arabidopsis thaliana	Metacaspase-8	36.243%	Swiss-Prot	moderate database homology
`O64518`	Arabidopsis thaliana	Metacaspase-5	53.548%	Swiss-Prot	weak database homology
`O64517`	Arabidopsis thaliana	Metacaspase-4	47.458%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card