LXL04_019147 | RubberDandelionOmics

Gene overview

LXL04_019147

Reference: OH-1004 Chr: Chr04 Coordinates: 24687999-24690035 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

960 bp · LXL04_019147|LXL04_019147|OH1004|cDNA

ATGGCCGCCGTGCTATCAAAAACTGGTCACCTCCGTCGTGCTTACCGACTCTTATCTTACACTCGGTCAACACTTCAACTCTCCAATGAAATTCCCAAATCACCTCTCCACCGACCTCTTCCTCAATCGGACTTAGGATCATTTACAAAGCTCCCTAGGTTTCTATCTACCAATGCGAACGCGGCTGGCGGTGACGCTAATACTCAAGCTGATTCAGCATTAAAAGCTACTTCATCAGATTCTCACTCTGATCAGGGAAA...

CDS

Download CDS FASTA

960 bp · LXL04_019147|LXL04_019147|OH1004|CDS

ATGGCCGCCGTGCTATCAAAAACTGGTCACCTCCGTCGTGCTTACCGACTCTTATCTTACACTCGGTCAACACTTCAACTCTCCAATGAAATTCCCAAATCACCTCTCCACCGACCTCTTCCTCAATCGGACTTAGGATCATTTACAAAGCTCCCTAGGTTTCTATCTACCAATGCGAACGCGGCTGGCGGTGACGCTAATACTCAAGCTGATTCAGCATTAAAAGCTACTTCATCAGATTCTCACTCTGATCAGGGAAA...

Protein

Download Protein FASTA

319 aa · LXL04_019147|LXL04_019147|OH1004|PROTEIN

MAAVLSKTGHLRRAYRLLSYTRSTLQLSNEIPKSPLHRPLPQSDLGSFTKLPRFLSTNANAAGGDANTQADSALKATSSDSHSDQGKQSGDSNQSSEQGKSVRGGPISWLSFLLLIASGAGVIFYYDQEKKRHIEDINTSSTAVKQGPSAGKAAIGGPFNLINHHGKSVTENDFKGKWTLIYFGFTHCPDICPDELQKLAAAIDKIKVKSGIEIVPVFISVDPERDTVEQVGEYVKEFHPKLIGLTGDPEEVKKAARAYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019147`
TK1151 ID	TkA05G023190
OH-1004 ID	LXL04_019147
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 92.929 / OH-1004 57.680 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019147

Location Chr04:24687999-24690035 (-)

Description Similar to HCC1: Protein SCO1 homolog 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g08950`	Acts as a copper chaperone, delivering copper to the Cu(A) site on the cytochrome c oxidase subunit II (COX2) (By similarity).	HCC1, the Arabidopsis homologue of the yeast mitochondrial copper chaperone SCO1, is essential for embryonic development.2011 · DOI: 10.1093/jxb/erq269

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019147 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006878 intracellular copper ion homeostasis Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0006882 intracellular zinc ion homeostasis Biological Process

GO:0006955 immune response Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0009306 protein secretion Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010467 gene expression Biological Process

GO:0010608 post-transcriptional regulation of gene expression Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0033617 mitochondrial respiratory chain complex IV assembly Biological Process

GO:0035264 multicellular organism growth Biological Process

KEGG gene cross-reference

ath:AT3G08950

bta:508586

hsa:6341

mmu:52892

spo:2539826

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.963

Rank 1 · LXL04_019147 · OH-1004

Cytoplasm0.077

Rank 2 · LXL04_019147 · OH-1004

Nucleus0.072

Rank 3 · LXL04_019147 · OH-1004

Cell membrane0.041

Rank 4 · LXL04_019147 · OH-1004

Endoplasmic reticulum0.020

Rank 5 · LXL04_019147 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02630.22SCO1-SenC150-308 aa

PF00578.28AhpC-TSA159-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019147	`PF02630.22`	SCO1-SenC	150	308	8e-60	202.0
LXL04_019147	`PF00578.28`	AhpC-TSA	159	265	7.8e-08	33.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYP0`	Arabidopsis thaliana	Cytochrome c oxidase assembly factor HCC1	55.917%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card