LXL04_018199 | RubberDandelionOmics

Gene overview

LXL04_018199

Reference: OH-1004 Chr: Chr04 Coordinates: 8547200-8549949 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2418 bp · LXL04_018199|LXL04_018199|OH1004|cDNA

ATGTCAACGACCTCATTGGAACTCTCTGTCAAACTCATCTTAAGATCAGTAGCAAAACCCATACCAAGAATCATCATGATGAGCATTAAAGACTGGGTTGTATCACAGTTGGTCTCAAACTCATTGGCCTCAACAAGACCATTGTCAGGCAGTGATAGCTTCTTTGAAGAACGCCCTCCTAACGACTTCACCATTCATGGTTCCAGTCAAACCACCACCTCGCCACCACCAGAGGCGGCAACAGATGTCTCACAACCACC...

CDS

Download CDS FASTA

2418 bp · LXL04_018199|LXL04_018199|OH1004|CDS

ATGTCAACGACCTCATTGGAACTCTCTGTCAAACTCATCTTAAGATCAGTAGCAAAACCCATACCAAGAATCATCATGATGAGCATTAAAGACTGGGTTGTATCACAGTTGGTCTCAAACTCATTGGCCTCAACAAGACCATTGTCAGGCAGTGATAGCTTCTTTGAAGAACGCCCTCCTAACGACTTCACCATTCATGGTTCCAGTCAAACCACCACCTCGCCACCACCAGAGGCGGCAACAGATGTCTCACAACCACC...

Protein

Download Protein FASTA

805 aa · LXL04_018199|LXL04_018199|OH1004|PROTEIN

MSTTSLELSVKLILRSVAKPIPRIIMMSIKDWVVSQLVSNSLASTRPLSGSDSFFEERPPNDFTIHGSSQTTTSPPPEAATDVSQPPIRSQEPPHPSPLLPPTFESSHQPQTPQKNLNPLEKIENLQIKFFRLLHHLGHSTNNLIVAKVLYRIHLATLIRTQESDLKKVNLNSDRAKAIAVQQETSGQTELDFSFSILVLGKTGVGKSSTINSILNELKAHTNAFRPATERVQEVSGIVSGIKISFIDTPGLLPSSPNTI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018199`
TK1151 ID	TkA08G020700
OH-1004 ID	LXL04_018199
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 84.099 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018199

Location Chr04:8547200-8549949 (-)

Description Similar to TOC90: Translocase of chloroplast 90, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20300`	GTPase involved in protein precursor import into chloroplasts.	AtToc90, a new GTP-binding component of the Arabidopsis chloroplast protein import machinery.2004 · DOI: 10.1023/b:plan.0000036374.92546.51

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018199 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0045036 protein targeting to chloroplast Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009707 chloroplast outer membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G20300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.242

Rank 1 · LXL04_018199 · OH-1004

Cytoplasm0.217

Rank 2 · LXL04_018199 · OH-1004

Mitochondrion0.181

Rank 3 · LXL04_018199 · OH-1004

Nucleus0.152

Rank 4 · LXL04_018199 · OH-1004

Cell membrane0.140

Rank 5 · LXL04_018199 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04548.23AIG1196-344 aa

PF01926.30MMR_HSR1197-262 aa

PF11886.14TOC159_MAD522-788 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018199	`PF04548.23`	AIG1	196	344	2.3e-19	70.3
LXL04_018199	`PF01926.30`	MMR_HSR1	197	262	3e-10	40.9
LXL04_018199	`PF11886.14`	TOC159_MAD	522	788	4.9e-104	347.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6S5G3`	Arabidopsis thaliana	Translocase of chloroplast 90, chloroplastic	50.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card