LXL04_017147 | RubberDandelionOmics

Gene overview

LXL04_017147

Reference: OH-1004 Chr: Chr03 Coordinates: 142009235-142013656 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2250 bp · LXL04_017147|LXL04_017147|OH1004|cDNA

ATGGACGACGATGAATCAAAGAAAACACTATCGGATTTCTTGACGGAATATCACTCCGATCAGATCGAGTCGATCCTTCTCTCCTCCGATCATCGCCTTCATTACCCCCTTTATGTCGATTTTGCTGAAGTGATGGAGCACGATTCTCCACTTGCTCATGAGATCCTTTTCGAACCAACGAAGTACTTGCCTGTGTTCGACGAAGCAGCTACATTGGCTCAGGAGAACATGTATGGACAGACGAAGAAAGTTTGGGAGCA...

CDS

Download CDS FASTA

2250 bp · LXL04_017147|LXL04_017147|OH1004|CDS

ATGGACGACGATGAATCAAAGAAAACACTATCGGATTTCTTGACGGAATATCACTCCGATCAGATCGAGTCGATCCTTCTCTCCTCCGATCATCGCCTTCATTACCCCCTTTATGTCGATTTTGCTGAAGTGATGGAGCACGATTCTCCACTTGCTCATGAGATCCTTTTCGAACCAACGAAGTACTTGCCTGTGTTCGACGAAGCAGCTACATTGGCTCAGGAGAACATGTATGGACAGACGAAGAAAGTTTGGGAGCA...

Protein

Download Protein FASTA

749 aa · LXL04_017147|LXL04_017147|OH1004|PROTEIN

MDDDESKKTLSDFLTEYHSDQIESILLSSDHRLHYPLYVDFAEVMEHDSPLAHEILFEPTKYLPVFDEAATLAQENMYGQTKKVWEHESRKEGYDRPFPTIKEFVHVRIEIRGPMLDNPGTILLFNKFSSYFMNLTVPHYLELCPSIGRVRVKHRGILLTLKGTVIRSGSIKMIEGEREYECRKCKHRFKVHPELESRNSIPKPLFCPSKVIFHSLLLPKGSCGSTSFQLLEGNKVCHDYQEIKIQESTQVLGVGAIPRS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017147`
TK1151 ID	TkA02G072590
OH-1004 ID	LXL04_017147
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 98.891 / OH-1004 83.311 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017147

Location Chr03:142009235-142013656 (+)

Description Similar to MCM9: Probable DNA helicase MCM9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g14050`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8B406`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release
`Os06g0218500`	Probable DNA helicase that may play a role in DNA repair during meiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017147 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007276 gamete generation Biological Process

GO:0007292 female gamete generation Biological Process

GO:0030174 regulation of DNA-templated DNA replication initiation Biological Process

GO:0036298 recombinational interstrand cross-link repair Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0042555 MCM complex Cellular Component

GO:0097362 MCM8-MCM9 complex Cellular Component

KEGG gene cross-reference

ath:AT2G14050

bta:100139498

dosa:Os06g0218500

osa:4340503

xla:431809

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.727

Rank 1 · LXL04_017147 · OH-1004

Cytoplasm0.229

Rank 2 · LXL04_017147 · OH-1004

Mitochondrion0.075

Rank 3 · LXL04_017147 · OH-1004

Cell membrane0.025

Rank 4 · LXL04_017147 · OH-1004

Plastid0.018

Rank 5 · LXL04_017147 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26066.1MCM9_N5-109 aa

PF14551.12MCM_N10-77 aa

PF17207.10MCM_OB150-286 aa

PF00493.30MCM345-548 aa

PF07728.21AAA_5388-504 aa

PF01078.28Mg_chelatase438-530 aa

PF17855.8MCM_lid569-650 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017147	`PF26066.1`	MCM9_N	5	109	1.7e-13	51.1
LXL04_017147	`PF14551.12`	MCM_N	10	77	1.6e-06	29.2
LXL04_017147	`PF17207.10`	MCM_OB	150	286	2.1e-22	80.0
LXL04_017147	`PF00493.30`	MCM	345	548	8.2e-74	248.2
LXL04_017147	`PF07728.21`	AAA_5	388	504	1e-06	29.5
LXL04_017147	`PF01078.28`	Mg_chelatase	438	530	1.2e-07	32.1
LXL04_017147	`PF17855.8`	MCM_lid	569	650	2e-19	70.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IFF3`	Arabidopsis thaliana	Probable DNA helicase MCM9	67.857%	Swiss-Prot	strong database homology
`B8B406`	Oryza sativa subsp. indica	Probable DNA helicase MCM9	66.032%	Swiss-Prot	strong database homology
`Q69QA6`	Oryza sativa subsp. japonica	DNA helicase MCM9	65.593%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card