LXL04_016524 | RubberDandelionOmics

Gene overview

LXL04_016524

Reference: OH-1004 Chr: Chr03 Coordinates: 125726930-125729648 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1845 bp · LXL04_016524|LXL04_016524|OH1004|cDNA

ATGGGTATTGATGGCGAGTCTGATGTGGCCCATGTGTCCGTTGAAAATGGGAAGAAAGAGAGCAGTATCAATGGCCATGTTGCTGAAAACGAATCTGTTACAGTTGCAAAAGATTCAGTTCGTGTAGAACCAACAGCTGAAATGAGCTTTCCAAACAATGCAGTTGATGAATGGCCAGAAGCTAAAAAGTTTCACTCTGTTTACTTTGTTAAATACCGAACAGTTGAAGACCAAAACCTCAAAACTAAACTCGATCAGGC...

CDS

Download CDS FASTA

1845 bp · LXL04_016524|LXL04_016524|OH1004|CDS

ATGGGTATTGATGGCGAGTCTGATGTGGCCCATGTGTCCGTTGAAAATGGGAAGAAAGAGAGCAGTATCAATGGCCATGTTGCTGAAAACGAATCTGTTACAGTTGCAAAAGATTCAGTTCGTGTAGAACCAACAGCTGAAATGAGCTTTCCAAACAATGCAGTTGATGAATGGCCAGAAGCTAAAAAGTTTCACTCTGTTTACTTTGTTAAATACCGAACAGTTGAAGACCAAAACCTCAAAACTAAACTCGATCAGGC...

Protein

Download Protein FASTA

614 aa · LXL04_016524|LXL04_016524|OH1004|PROTEIN

MGIDGESDVAHVSVENGKKESSINGHVAENESVTVAKDSVRVEPTAEMSFPNNAVDEWPEAKKFHSVYFVKYRTVEDQNLKTKLDQADKELKKLNLSRDPILEKLRAKRTERAQVIGQLKALVEEKNHFRSIMDDKRKEIEPLQQALGKLRGPRDANRDNRSFICSSEAELNDVIKSMQYRIQHESITLNEEKQIIREIKQLEGTRDKVIANAAMRAEVQKSVGEKDAIQDQVKSIGVDLDGVRKDQQAIKTKVKTLEVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016524`
TK1151 ID	TkA02G128840
OH-1004 ID	LXL04_016524
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016524

Location Chr03:125726930-125729648 (+)

Description Similar to PPI1: Proton pump-interactor 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27500`	Promotes AHA1 plasma membrane ATPase activity by binding to a site different from the 14-3-3 binding site.	No verified direct reference in this release
`At3g15340`	May regulate plasma membrane ATPase activity.	No verified direct reference in this release
`At5g36690`	May regulate plasma membrane ATPase activity.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0390000`	May regulate plasma membrane ATPase activity.	No verified direct reference in this release
`Os09g0346400`	May regulate plasma membrane ATPase activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016524 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010155 regulation of proton transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G15340

ath:AT4G27500

ath:AT5G36690

ath:AT5G36780

dosa:Os08g0390000

dosa:Os09g0346400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.448

Rank 1 · LXL04_016524 · OH-1004

Nucleus0.204

Rank 2 · LXL04_016524 · OH-1004

Endoplasmic reticulum0.172

Rank 3 · LXL04_016524 · OH-1004

Cell membrane0.167

Rank 4 · LXL04_016524 · OH-1004

Golgi apparatus0.107

Rank 5 · LXL04_016524 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28572.2PPI_helical64-371 aa

PF27883.1PPI_C467-502 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016524	`PF28572.2`	PPI_helical	64	371	3e-59	201.6
LXL04_016524	`PF27883.1`	PPI_C	467	502	2.7e-10	40.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23144`	Arabidopsis thaliana	Proton pump-interactor 1	48.829%	Swiss-Prot	moderate database homology
`B3H4K7`	Arabidopsis thaliana	Proton pump-interactor 2	33.275%	Swiss-Prot	moderate database homology
`P0DKC0`	Arabidopsis thaliana	Proton pump-interactor 3B	29.779%	Swiss-Prot	weak database homology
`Q6ZBF6`	Oryza sativa subsp. japonica	Proton pump-interactor BIP131	44.444%	Swiss-Prot	moderate database homology
`Q762B4`	Oryza sativa subsp. japonica	Proton pump-interactor BIP103	40.721%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card