LXL04_015821 | RubberDandelionOmics

Gene overview

LXL04_015821

Reference: OH-1004 Chr: Chr03 Coordinates: 87467304-87472341 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2373 bp · LXL04_015821|LXL04_015821|OH1004|cDNA

ATGGCTCCTCCGGCTCAATCTCAGCGATCTCCTTCCCCATCTCAACCCTCCGGTAAAGGGGAGGTATCGGATCTGAAAATGCAGCTTCGACAGCTGGCTGGGAGTCGGGCACCTGGGACTGACGACTCTAAACGAGATCTCTTCAAGAAGGTGATCTCTTACATGACCATAGGGATCGATGTGTCCTCAGTTTTCAGCGAGATGGTGATGTGCTCGGCTACTTCAGATATTGTTTTGAAGAAAATGTGTTACCTGTATGT...

CDS

Download CDS FASTA

2373 bp · LXL04_015821|LXL04_015821|OH1004|CDS

ATGGCTCCTCCGGCTCAATCTCAGCGATCTCCTTCCCCATCTCAACCCTCCGGTAAAGGGGAGGTATCGGATCTGAAAATGCAGCTTCGACAGCTGGCTGGGAGTCGGGCACCTGGGACTGACGACTCTAAACGAGATCTCTTCAAGAAGGTGATCTCTTACATGACCATAGGGATCGATGTGTCCTCAGTTTTCAGCGAGATGGTGATGTGCTCGGCTACTTCAGATATTGTTTTGAAGAAAATGTGTTACCTGTATGT...

Protein

Download Protein FASTA

790 aa · LXL04_015821|LXL04_015821|OH1004|PROTEIN

MAPPAQSQRSPSPSQPSGKGEVSDLKMQLRQLAGSRAPGTDDSKRDLFKKVISYMTIGIDVSSVFSEMVMCSATSDIVLKKMCYLYVGNYAKYNPDLALLTINFLQRDCKDEDPMIRGLALRSLCSLRVPNLVEYLVGPLGAGLKDGNSYVRMVAAVGVLKLYHISASTCLDADFPDLLKHLMLNDPDAQVVANCLSALQEIWGLEASSSEEAAREREGLISKPIIYFLLNRIKEFSEWAQCTILELVSKYAPPDSNEIF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015821`
TK1151 ID	TkA02G210350
OH-1004 ID	LXL04_015821
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015821

Location Chr03:87467304-87472341 (+)

Description Similar to BETAA-AD: Beta-adaptin-like protein A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g11490`	Subunit of clathrin-associated adaptor protein complex that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015821 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006605 protein targeting Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0061938 protein localization to somatodendritic compartment Biological Process

GO:0072583 clathrin-dependent endocytosis Biological Process

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005905 clathrin-coated pit Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G11490

bta:282183

ddi:DDB_G0283319

mmu:67489

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.525

Rank 1 · LXL04_015821 · OH-1004

Golgi apparatus0.408

Rank 2 · LXL04_015821 · OH-1004

Nucleus0.183

Rank 3 · LXL04_015821 · OH-1004

Lysosome / Vacuole0.156

Rank 4 · LXL04_015821 · OH-1004

Endoplasmic reticulum0.136

Rank 5 · LXL04_015821 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01602.27Adaptin_N39-374 aa

PF12717.14Cnd1115-287 aa

PF01602.27Adaptin_N387-533 aa

PF09066.16B2-adapt-app_C671-784 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015821	`PF01602.27`	Adaptin_N	39	374	3.6e-84	283.9
LXL04_015821	`PF12717.14`	Cnd1	115	287	1.9e-45	155.5
LXL04_015821	`PF01602.27`	Adaptin_N	387	533	3.6e-84	283.9
LXL04_015821	`PF09066.16`	B2-adapt-app_C	671	784	5.7e-23	81.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LDK9`	Arabidopsis thaliana	Beta-adaptin-like protein A	72.716%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card