LXL04_014925 | RubberDandelionOmics

Gene overview

LXL04_014925

Reference: OH-1004 Chr: Chr03 Coordinates: 59706577-59713908 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3768 bp · LXL04_014925|LXL04_014925|OH1004|cDNA

ATGGATGTTTTTAGTGAAATTATGAAGCCGGTTGTTCAGGTTCTCATGGTTCCTGCAAAAAAAGAACTAGGTTATTTGATTTCATGTGCAACACATGTGAAGGACATGCGTAGAAAAATGACAGAGTTGGAAGTTGCAAAATGCGGTGAGGAAGAGCACTTGAACCGGAACACAGAAAACCGTTTAGAGATTTCATCTCAAGTGAGGGAATGGTTGGAAAAAGTAAAAAACATTAATGCAAAGGTGGAAAACTTTCCAAG...

CDS

Download CDS FASTA

3768 bp · LXL04_014925|LXL04_014925|OH1004|CDS

ATGGATGTTTTTAGTGAAATTATGAAGCCGGTTGTTCAGGTTCTCATGGTTCCTGCAAAAAAAGAACTAGGTTATTTGATTTCATGTGCAACACATGTGAAGGACATGCGTAGAAAAATGACAGAGTTGGAAGTTGCAAAATGCGGTGAGGAAGAGCACTTGAACCGGAACACAGAAAACCGTTTAGAGATTTCATCTCAAGTGAGGGAATGGTTGGAAAAAGTAAAAAACATTAATGCAAAGGTGGAAAACTTTCCAAG...

Protein

Download Protein FASTA

1255 aa · LXL04_014925|LXL04_014925|OH1004|PROTEIN

MDVFSEIMKPVVQVLMVPAKKELGYLISCATHVKDMRRKMTELEVAKCGEEEHLNRNTENRLEISSQVREWLEKVKNINAKVENFPSDVGSCFNIMDRHKLGRKAFQILEEIESVTTQHSLITWSDRPIPLGRVDSTRTSVSAPLTTNHHEDFQSRNQTFLEALKAFQPNHKSHMIALCGMGGVGKTTMMEKLKKVAEKKKMFNYIVEVVIGENTDPIAAIQDVVATYIGIELKEKDKRARANKLCQGFKAKSDGGKNKF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014925`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014925

Location Chr03:59706577-59713908 (+)

Description Similar to RPS2: Disease resistance protein RPS2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26090`	Disease resistance (R) protein that specifically recognizes the AvrRpt2 type III effector avirulence protein from Pseudomonas syringae.	No verified direct reference in this release
`At4g27220`	Probable disease resistance protein.	No verified direct reference in this release
`At1g61180`	Involved in disease resistance via the salicylic acid (SA) signaling pathway.	No verified direct reference in this release
`At4g27190`	Disease resistance protein.	No verified direct reference in this release
`At1g12280`	Disease resistance protein that mediates defense responses against the bacterial pathogen Pseudomonas syringae pv tomato strain DC3000, and the virulent oomycete Hyaloperonospora arabidopsidis isolate Noco2.	The MEKK1-MKK1/MKK2-MPK4 kinase cascade negatively regulates immunity mediated by a mitogen-activated protein kinase kinase kinase in Arabidopsis.2012 · DOI: 10.1105/tpc.112.097253

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014925 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002220 innate immune response activating cell surface receptor signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016045 detection of bacterium Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0098542 defense response to other organism Biological Process

GO:2000377 regulation of reactive oxygen species metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G12280

ath:AT1G61180

ath:AT4G26090

ath:AT4G27190

ath:AT4G27220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.590

Rank 1 · LXL04_014925 · OH-1004

Cytoplasm0.242

Rank 2 · LXL04_014925 · OH-1004

Nucleus0.183

Rank 3 · LXL04_014925 · OH-1004

Endoplasmic reticulum0.117

Rank 4 · LXL04_014925 · OH-1004

Extracellular0.049

Rank 5 · LXL04_014925 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00931.29NB-ARC170-331 aa

PF23598.2LRR_14534-614 aa

PF23247.2LRR_RPS2740-844 aa

PF23247.2LRR_RPS2862-1016 aa

PF23247.2LRR_RPS21038-1127 aa

PF23247.2LRR_RPS21134-1226 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014925	`PF00931.29`	NB-ARC	170	331	3.2e-26	92.7
LXL04_014925	`PF23598.2`	LRR_14	534	614	1.9e-09	37.5
LXL04_014925	`PF23247.2`	LRR_RPS2	740	844	3.6e-65	219.5
LXL04_014925	`PF23247.2`	LRR_RPS2	862	1016	3.6e-65	219.5
LXL04_014925	`PF23247.2`	LRR_RPS2	1038	1127	3.6e-65	219.5
LXL04_014925	`PF23247.2`	LRR_RPS2	1134	1226	3.6e-65	219.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42484`	Arabidopsis thaliana	Disease resistance protein RPS2	25.806%	Swiss-Prot	weak database homology
`O81825`	Arabidopsis thaliana	Probable disease resistance protein At4g27220	25.666%	Swiss-Prot	weak database homology
`Q940K0`	Arabidopsis thaliana	Disease resistance protein UNI	26.156%	Swiss-Prot	weak database homology
`Q9T048`	Arabidopsis thaliana	Disease resistance protein At4g27190	25.170%	Swiss-Prot	weak database homology
`P60838`	Arabidopsis thaliana	Disease resistance protein SUMM2	27.619%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card