RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_014872
Reference: OH-1004 Chr: Chr03 Coordinates: 58397920-58401597 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1548 bp · LXL04_014872|LXL04_014872|OH1004|cDNA

ATGGCATCACGACAAGATCCTAGGGCAGGAGAAGATGTAACAGGAAAGGAAGTGAGGGCGGAGGAGGCCGCGAGATTCGCCGCAGATGAACTCCGAGACGTCAACAAACAAAGAGGAGTTGGTGGTACCGGCGGGGCGTCTGAAGTTGTTGTCGAGCACCATCAAACACCATCCGAACAGAACCGTCCCGGAATCATTGGAAGCATTTTTCAAACGGTTACCGGCACTCTCGGTGGCGCCAAAGATGCCGTCATCGGAAA...

CDS

Download CDS FASTA

1548 bp · LXL04_014872|LXL04_014872|OH1004|CDS

ATGGCATCACGACAAGATCCTAGGGCAGGAGAAGATGTAACAGGAAAGGAAGTGAGGGCGGAGGAGGCCGCGAGATTCGCCGCAGATGAACTCCGAGACGTCAACAAACAAAGAGGAGTTGGTGGTACCGGCGGGGCGTCTGAAGTTGTTGTCGAGCACCATCAAACACCATCCGAACAGAACCGTCCCGGAATCATTGGAAGCATTTTTCAAACGGTTACCGGCACTCTCGGTGGCGCCAAAGATGCCGTCATCGGAAA...

Protein

Download Protein FASTA

515 aa · LXL04_014872|LXL04_014872|OH1004|PROTEIN

MASRQDPRAGEDVTGKEVRAEEAARFAADELRDVNKQRGVGGTGGASEVVVEHHQTPSEQNRPGIIGSIFQTVTGTLGGAKDAVIGKTHEATEKASVVSQDAAERERRNRDETARKAEEYKNTAAEKAKEAKDTTMRKAGESKDYTAQKAGEAANKAGEYKDYTTQKAKETADSAAQKTKEAKDTTMGKMGEYKDYAAEKTKETADATAQKAKEAKDYTVDKAVAAKDYTAEKTKQTADATAQKAKEAKDATMEKMGEYK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_014872
TK1151 IDTkA02G387310
OH-1004 IDLXL04_014872
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 99.773 / OH-1004 85.243
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_014872
LocationChr03:58397920-58401597 (+)
DescriptionSimilar to Embryonic protein DC-8
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g36640 May be involved in the BHLH109-mediated regulation of somatic embryogenesis.
Stress-related function of bHLH109 in somatic embryo induction in Arabidopsis.2016 · DOI: 10.1016/j.jplph.2016.02.012
At3g53040 May function in the proximal abscission zone cells to prevent water loss after floral organ shedding (Probable).
A gene co-expression network predicts functional genes controlling the re-establishment of desiccation tolerance in germinated Arabidopsis thaliana seeds.2015 · DOI: 10.1007/s00425-015-2283-7

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0322900 Involved in abiotic stress responses.
OsLEA3-2, an abiotic stress induced gene of rice plays a key role in salt and drought tolerance.2012 · DOI: 10.1371/journal.pone.0045117
UniProt: A2XG55 Late embryogenesis abundant protein 1. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014872 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009631 cold acclimation Biological Process
GO:0010227 floral organ abscission Biological Process
GO:0050826 response to freezing Biological Process
GO:1901002 positive regulation of response to salt stress Biological Process
GO:1902584 positive regulation of response to water deprivation Biological Process
GO:0005634 nucleus Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
ath:AT2G36640
ath:AT3G53040
dosa:Os03g0322900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.601
Rank 1 · LXL04_014872 · OH-1004
Nucleus0.275
Rank 2 · LXL04_014872 · OH-1004
Cell membrane0.182
Rank 3 · LXL04_014872 · OH-1004
Mitochondrion0.095
Rank 4 · LXL04_014872 · OH-1004
Extracellular0.051
Rank 5 · LXL04_014872 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02987.22LEA_4102-141 aa
PF02987.22LEA_4121-153 aa
PF02987.22LEA_4143-181 aa
PF02987.22LEA_4172-210 aa
PF02987.22LEA_4206-241 aa
PF02987.22LEA_4238-273 aa
PF02987.22LEA_4272-314 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_014872PF02987.22LEA_41021411.3e-61205.0
LXL04_014872PF02987.22LEA_41211531.3e-61205.0
LXL04_014872PF02987.22LEA_41431811.3e-61205.0
LXL04_014872PF02987.22LEA_41722101.3e-61205.0
LXL04_014872PF02987.22LEA_42062411.3e-61205.0
LXL04_014872PF02987.22LEA_42382731.3e-61205.0
LXL04_014872PF02987.22LEA_42723141.3e-61205.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SKP0Arabidopsis thalianaLate embryogenesis abundant protein ECP6344.787%Swiss-Protmoderate database homology
Q9LF88Arabidopsis thalianaLate embryogenesis abundant protein At3g5304048.549%Swiss-Protmoderate database homology
A3AHG5Oryza sativa subsp. japonicaLate embryogenesis abundant protein 1751.128%Swiss-Protweak database homology
A2XG55Oryza sativa subsp. indicaLate embryogenesis abundant protein 151.587%Swiss-Protweak database homology

JBrowse

View in Genome Browser