LXL04_013216 | RubberDandelionOmics

Gene overview

LXL04_013216

Reference: OH-1004 Chr: Chr03 Coordinates: 26123968-26127426 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1914 bp · LXL04_013216|LXL04_013216|OH1004|cDNA

ATGGAGGCAGAACCAAAACCATCGTCGGAGGAGGCGCCGACTTGCTGGAGAAAAGAATTGGACACCTACCTCAAGAGGCTCCAATCTCTTCTATTCGGTGCGGACACAGCTATCGAGAAGCGAGATTACTCTTATGCTCAACTACTCTTACTCCGTCTCATCGGCTTTCTAGATTCTCGGACCCTCACCGACGACGACGAAGCCTTCATTCGACCAATTCGCCGTGAAGCCCTCTCGAAACTGGAATCCGCTAGTCAAGC...

CDS

Download CDS FASTA

1914 bp · LXL04_013216|LXL04_013216|OH1004|CDS

ATGGAGGCAGAACCAAAACCATCGTCGGAGGAGGCGCCGACTTGCTGGAGAAAAGAATTGGACACCTACCTCAAGAGGCTCCAATCTCTTCTATTCGGTGCGGACACAGCTATCGAGAAGCGAGATTACTCTTATGCTCAACTACTCTTACTCCGTCTCATCGGCTTTCTAGATTCTCGGACCCTCACCGACGACGACGAAGCCTTCATTCGACCAATTCGCCGTGAAGCCCTCTCGAAACTGGAATCCGCTAGTCAAGC...

Protein

Download Protein FASTA

637 aa · LXL04_013216|LXL04_013216|OH1004|PROTEIN

MEAEPKPSSEEAPTCWRKELDTYLKRLQSLLFGADTAIEKRDYSYAQLLLLRLIGFLDSRTLTDDDEAFIRPIRREALSKLESASQALVPDSDRQAFEQAGKDPGVTFRKQGDLNIEKIKQSKYFKALLQHSKGDTLNEDDEPQKKEDIISKTSKVTLHGKSTTCISRTNNNMHNNSIHSVGNGLKDCNLLNVDEERTNGSYFRPKRSRMEIHSPKDETVISPSSNNKPDTNVTSNGFVTARTKLEMDVRQKRGLAGSPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013216`
TK1151 ID	TkA02G511150
OH-1004 ID	LXL04_013216
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 98.760 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013216

Location Chr03:26123968-26127426 (-)

Description Similar to FIGL1: ATPase family AAA domain-containing protein FIGL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27120`	Involved in DNA double-strand break (DSB) repair via homologous recombination (HR).	AAA-ATPase FIDGETIN-LIKE 1 and Helicase FANCM Antagonize Meiotic Crossovers by Distinct Mechanisms.2015 · DOI: 10.1371/journal.pgen.1005369

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013216 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0007140 male meiotic nuclear division Biological Process

GO:0010569 regulation of double-strand break repair via homologous recombination Biological Process

GO:0033687 osteoblast proliferation Biological Process

GO:0035825 homologous recombination Biological Process

GO:0036297 interstrand cross-link repair Biological Process

GO:0045128 negative regulation of reciprocal meiotic recombination Biological Process

GO:0046034 ATP metabolic process Biological Process

GO:0051013 microtubule severing Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0071479 cellular response to ionizing radiation Biological Process

KEGG gene cross-reference

ath:AT3G27120

hsa:63979

mmu:60530

rno:289777

xtr:100124890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.524

Rank 1 · LXL04_013216 · OH-1004

Cytoplasm0.384

Rank 2 · LXL04_013216 · OH-1004

Cell membrane0.098

Rank 3 · LXL04_013216 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_013216 · OH-1004

Plastid0.040

Rank 5 · LXL04_013216 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24347.2FIGL1_N14-86 aa

PF00004.36AAA393-523 aa

PF07728.21AAA_5393-514 aa

PF17862.8AAA_lid_3548-585 aa

PF09336.17Vps4_C596-630 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013216	`PF24347.2`	FIGL1_N	14	86	2.1e-34	117.9
LXL04_013216	`PF00004.36`	AAA	393	523	1.1e-39	136.6
LXL04_013216	`PF07728.21`	AAA_5	393	514	9.8e-07	29.6
LXL04_013216	`PF17862.8`	AAA_lid_3	548	585	6.3e-10	39.1
LXL04_013216	`PF09336.17`	Vps4_C	596	630	4.8e-09	36.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JEX5`	Arabidopsis thaliana	ATPase family AAA domain-containing protein FIGL1	64.632%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card