LXL04_012748 | RubberDandelionOmics

Gene overview

LXL04_012748

Reference: OH-1004 Chr: Chr03 Coordinates: 18101062-18102009 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_012748|LXL04_012748|OH1004|cDNA

ATGGCAAAATCAGGAAAAGGTCGGAGGTTCATTGTCTCCTCTATCATCTTCATCGCGTTTCTTTGCACCATTGCTTCCATAAATGAACTCCGATTTGACCATTTATTACGGTTTAGCCGATGTGCCCTAAAGTTGGAGGACACTCTACCGGTAAACGCCCCCGTAAACCCTTCAACAGACGAAATCCGTGTCCTTCTCGGAATCCTAACCCTACCGGACCACTACCACCGCCGCCACTTCCTCCGCCTCATTTACGCCAC...

CDS

Download CDS FASTA

948 bp · LXL04_012748|LXL04_012748|OH1004|CDS

ATGGCAAAATCAGGAAAAGGTCGGAGGTTCATTGTCTCCTCTATCATCTTCATCGCGTTTCTTTGCACCATTGCTTCCATAAATGAACTCCGATTTGACCATTTATTACGGTTTAGCCGATGTGCCCTAAAGTTGGAGGACACTCTACCGGTAAACGCCCCCGTAAACCCTTCAACAGACGAAATCCGTGTCCTTCTCGGAATCCTAACCCTACCGGACCACTACCACCGCCGCCACTTCCTCCGCCTCATTTACGCCAC...

Protein

Download Protein FASTA

315 aa · LXL04_012748|LXL04_012748|OH1004|PROTEIN

MAKSGKGRRFIVSSIIFIAFLCTIASINELRFDHLLRFSRCALKLEDTLPVNAPVNPSTDEIRVLLGILTLPDHYHRRHFLRLIYATQQMVPGAKVDVKFVFCNLTKEDQRVLIALEIMQYDDIIILNCKENMNNGKSYTYFSSLPDMFNEDSGSSGGAYPPYHYVMKGDDDAYFRLGQLVESLRVLPREDLYYGYTIPCDNMNPYGHYMSGMGYLISWDIVEWLKVSNIPKAHIDGPEDKVFGDWMEQGKKGKNRHNAK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012748`
TK1151 ID	TkA02G540320
OH-1004 ID	LXL04_012748
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012748

Location Chr03:18101062-18102009 (-)

Description Similar to GALT3: Hydroxyproline O-galactosyltransferase GALT3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g06440`	Possesses hydroxyproline O-galactosyltransferase activity.	A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein glycosylation, growth and development in Arabidopsis.2015 · DOI: 10.1186/s12870-015-0670-7

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012748 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010405 arabinogalactan protein metabolic process Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0080147 root hair cell development Biological Process

GO:0180062 protein O-linked glycosylation via galactose Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0008378 galactosyltransferase activity Molecular Function

GO:0030246 carbohydrate binding Molecular Function

GO:1990714 hydroxyproline O-galactosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G06440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.813

Rank 1 · LXL04_012748 · OH-1004

Endoplasmic reticulum0.094

Rank 2 · LXL04_012748 · OH-1004

Cytoplasm0.081

Rank 3 · LXL04_012748 · OH-1004

Cell membrane0.059

Rank 4 · LXL04_012748 · OH-1004

Extracellular0.047

Rank 5 · LXL04_012748 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01762.28Galactosyl_T77-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012748	`PF01762.28`	Galactosyl_T	77	198	2.2e-09	38.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASW1`	Arabidopsis thaliana	Hydroxyproline O-galactosyltransferase GALT3	25.532%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card